DNASU Plasmid Repository • 480.965.5697 | Email

PSMF1 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PSMF1
Gene Name:  proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
Sequence              Map: pANT7_cGST.doc
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: generated from ORFeome entry clone (IMAGE:100072474)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00404128

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 813nts         Open reading frame : 1 to 813
Reference Sequence Alignment

ATGGCGGGCCTGGAGGTACTGTTCGCATCGGCAGCGCCGGCCATCACCTGCAGGCAGGAC
GCGCTCGTCTGCTTCTTGCATTGGGAAGTGGTGACACACGGTTACTGCGGCTTGGGTGTC
GGTGACCAGCCGGGTCCCAATGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAAC
AATAAAGACCTGTATGTCCTCCGGTATGAGTATAAGGATGGGTCCAGAAAGCTCCTTGTG
AAAGCCATCACCGTGGAGAGCAGCATGATCCTCAATGTGCTGGAATATGGCTCACAGCAA
GTGGCAGACTTGACCCTGAACTTGGATGATTATATCGATGCAGAACACCTGGGTGACTTC
CACAGGACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATCATCACA
CCTATCCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCT
GCTACCGCCAGAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGG
CAGCCTCCCTGGTGTGATCCCCTGGGCCCGTTTGTTGTCGGGGGAGAAGACTTAGACCCT
TTTGGGCCTCGGAGAGGTGGCATGATTGTGGATCCCCTGAGATCTGGCTTCCCAAGAGCA
CTTATTGACCCTTCCTCAGGCCTCCCGAACCGACTTCCTCCAGGCGCTGTGCCCCCAGGA
GCTCGCTTTGACCCCTTTGGACCCATTGGGACCAGCCCACCCGGACCTAACCCAGACCAT
CTCCCCCCGCCGGGCTACGATGACATGTACCTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PSMF1
Symbol Nomenclature : PSMF1
SYNONYM : PI31
Designation : hPI31|proteasome inhibitor PI31 subunit|proteasome inhibitor hP131 subunit
Full Nomenclature : proteasome (prosome, macropain) inhibitor subunit 1 (PI31)
GENEID : 9491
Locus Tag : RP4-545L17.1
GenBank Accession : HQ258165
HGNC : 9571
Vega : OTTHUMG00000031656
Target GenBank: HQ258165

 

Reference Sequence Alignment

  

HsCD00404128        ATGGCGGGCCTGGAGGTACTGTTCGCATCGGCAGCGCCGGCCATCACCTGCAGGCAGGAC
XM_005260874.1      ATGGCGGGCCTGGAGGTACTGTTCGCATCGGCAGCGCCGGCCATCACCTGCAGGCAGGAC
NM_006814.3         ATGGCGGGCCTGGAGGTACTGTTCGCATCGGCAGCGCCGGCCATCACCTGCAGGCAGGAC
NM_178578.2         ATGGCGGGCCTGGAGGTACTGTTCGCATCGGCAGCGCCGGCCATCACCTGCAGGCAGGAC
XM_005260873.1      ATGGCGGGCCTGGAGGTACTGTTCGCATCGGCAGCGCCGGCCATCACCTGCAGGCAGGAC
                    ************************************************************

HsCD00404128        GCGCTCGTCTGCTTCTTGCATTGGGAAGTGGTGACACACGGTTACTGCGGCTTGGGTGTC
XM_005260874.1      GCGCTCGTCTGCTTCTTGCATTGGGAAGTGGTGACACACGGTTACTTCGGCTTGGGTGTC
NM_006814.3         GCGCTCGTCTGCTTCTTGCATTGGGAAGTGGTGACACACGGTTACTTCGGCTTGGGTGTC
NM_178578.2         GCGCTCGTCTGCTTCTTGCATTGGGAAGTGGTGACACACGGTTACTTCGGCTTGGGTGTC
XM_005260873.1      GCGCTCGTCTGCTTCTTGCATTGGGAAGTGGTGACACACGGTTACTTCGGCTTGGGTGTC
                    ********************************************** *************

HsCD00404128        GGTGACCAGCCGGGTCCCAATGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAAC
XM_005260874.1      GGTGACCAGCCGGGTCCCAATGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAAC
NM_006814.3         GGTGACCAGCCGGGTCCCAATGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAAC
NM_178578.2         GGTGACCAGCCGGGTCCCAATGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAAC
XM_005260873.1      GGTGACCAGCCGGGTCCCAATGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAAC
                    ************************************************************

HsCD00404128        AATAAAGACCTGTATGTCCTCCGGTATGAGTATAAGGATGGGTCCAGAAAGCTCCTTGTG
XM_005260874.1      AATAAAGACCTGTATGTCCTCCGGTATGAGTATAAGGATGGGTCCAGAAAGCTCCTTGTG
NM_006814.3         AATAAAGACCTGTATGTCCTCCGGTATGAGTATAAGGATGGGTCCAGAAAGCTCCTTGTG
NM_178578.2         AATAAAGACCTGTATGTCCTCCGGTATGAGTATAAGGATGGGTCCAGAAAGCTCCTTGTG
XM_005260873.1      AATAAAGACCTGTATGTCCTCCGGTATGAGTATAAGGATGGGTCCAGAAAGCTCCTTGTG
                    ************************************************************

HsCD00404128        AAAGCCATCACCGTGGAGAGCAGCATGATCCTCAATGTGCTGGAATATGGCTCACAGCAA
XM_005260874.1      AAAGCCATCACCGTGGAGAGCAGCATGATCCTCAATGTGCTGGAATATGGCTCACAGCAA
NM_006814.3         AAAGCCATCACCGTGGAGAGCAGCATGATCCTCAATGTGCTGGAATATGGCTCACAGCAA
NM_178578.2         AAAGCCATCACCGTGGAGAGCAGCATGATCCTCAATGTGCTGGAATATGGCTCACAGCAA
XM_005260873.1      AAAGCCATCACCGTGGAGAGCAGCATGATCCTCAATGTGCTGGAATATGGCTCACAGCAA
                    ************************************************************

HsCD00404128        GTGGCAGACTTGACCCTGAACTTGGATGATTATATCGATGCAGAACACCTGGGTGACTTC
XM_005260874.1      GTGGCAGACTTGACCCTGAACTTGGATGATTATATCGATGCAGAACACCTGGGTGACTTC
NM_006814.3         GTGGCAGACTTGACCCTGAACTTGGATGATTATATCGATGCAGAACACCTGGGTGACTTC
NM_178578.2         GTGGCAGACTTGACCCTGAACTTGGATGATTATATCGATGCAGAACACCTGGGTGACTTC
XM_005260873.1      GTGGCAGACTTGACCCTGAACTTGGATGATTATATCGATGCAGAACACCTGGGTGACTTC
                    ************************************************************

HsCD00404128        CACAGGACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATCATCACA
XM_005260874.1      CACAGGACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATCATCACA
NM_006814.3         CACAGGACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATCATCACA
NM_178578.2         CACAGGACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATCATCACA
XM_005260873.1      CACAGGACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATCATCACA
                    ************************************************************

HsCD00404128        CCTATCCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCT
XM_005260874.1      CCTATCCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCT
NM_006814.3         CCTATCCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCT
NM_178578.2         CCTATCCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCT
XM_005260873.1      CCTATCCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCT
                    ************************************************************

HsCD00404128        GCTACCGCCAGAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGG
XM_005260874.1      GCTACCGCCAGAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGG
NM_006814.3         GCTACCGCCAGAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGG
NM_178578.2         GCTACCGCCAGAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGG
XM_005260873.1      GCTACCGCCAGAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGG
                    ************************************************************

HsCD00404128        CAGCCTCCCTGGTGTGATCCCCTGGGCCCGTTTGTTGTCGGGGGAGAAGACTTAGACCCT
XM_005260874.1      CAGCCTCCCTGGTGTGATCCCCTGGGCCCGTTTGTTGTCGGGGGAGAAGACTTAGACCCT
NM_006814.3         CAGCCTCCCTGGTGTGATCCCCTGGGCCCGTTTGTTGTCGGGGGAGAAGACTTAGACCCT
NM_178578.2         CAGCCTCCCTGGTGTGATCCCCTGGGCCCGTTTGTTGTCGGGGGAGAAGACTTAGACCCT
XM_005260873.1      CAGCCTCCCTGGTGTGATCCCCTGGGCCCGTTTGTTGTCGGGGGAGAAGACTTAGACCCT
                    ************************************************************

HsCD00404128        TTTGGGCCTCGGAGAGGTGGCATGATTGTGGATCCCCTGAGATCTGGCTTCCCAAGAGCA
XM_005260874.1      TTTGGGCCTCGGAGAGGTGGCATGATTGTGGATCCCCTGAGATCTGGCTTCCCAAGAGCA
NM_006814.3         TTTGGGCCTCGGAGAGGTGGCATGATTGTGGATCCCCTGAGATCTGGCTTCCCAAGAGCA
NM_178578.2         TTTGGGCCTCGGAGAGGTGGCATGATTGTGGATCCCCTGAGATCTGGCTTCCCAAGAGCA
XM_005260873.1      TTTGGGCCTCGGAGAGGTGGCATGATTGTGGATCCCCTGAGATCTGGCTTCCCAAGAGCA
                    ************************************************************

HsCD00404128        CTTATTGACCCTTCCTCAGGCCTCCCGAACCGACTTCCTCCAGGCGCTGTGCCCCCAGGA
XM_005260874.1      CTTATTGACCCTTCCTCAGGCCTCCCGAACCGACTTCCTCCAGGCGCTGTGCCCCCAGGA
NM_006814.3         CTTATTGACCCTTCCTCAGGCCTCCCGAACCGACTTCCTCCAGGCGCTGTGCCCCCAGGA
NM_178578.2         CTTATTGACCCTTCCTCAGGCCTCCCGAACCGACTTCCTCCAGGCGCTGTGCCCCCAGGA
XM_005260873.1      CTTATTGACCCTTCCTCAGGCCTCCCGAACCGACTTCCTCCAGGCGCTGTGCCCCCAGGA
                    ************************************************************

HsCD00404128        GCTCGCTTTGACCCCTTTGGACCCATTGGGACCAGCCCACCCGGACCTAACCCAGACCAT
XM_005260874.1      GCTCGCTTTGACCCCTTTGGACCCATTGGGACCAGCCCACCCGGGTACGTAGTCACTCAG
NM_006814.3         GCTCGCTTTGACCCCTTTGGACCCATTGGGACCAGCCCACCCGGACCTAACCCAGACCAT
NM_178578.2         GCTCGCTTTGACCCCTTTGGACCCATTGGGACCAGCCCACCCGGACCTAACCCAGACCAT
XM_005260873.1      GCTCGCTTTGACCCCTTTGGACCCATTGGGACCAGCCCACCCGGCCCGAGGCCTGACAGA
                    ********************************************  . .     .. .. 

HsCD00404128        CTCCCCCCGCCGGGCTACGATGACATGTACCTG---
XM_005260874.1      CCCGAGGCCTGA------------------------
NM_006814.3         CTCCCCCCGCCGGGCTACGATGACATGTACCTGTGA
NM_178578.2         CTCCCCCCGCCGGGCTACGATGACATGTACCTGTGA
XM_005260873.1      CGCGGGCAGTGA------------------------
                    * *    .   .                        

Pathways

Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Securin
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Antigen processing-Cross presentation
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Apoptosis
Reactome : Assembly of the pre-replicative complex
Reactome : Asymmetric localization of PCP proteins
Reactome : Autodegradation of Cdh1 by Cdh1:APC/C
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : CDK-mediated phosphorylation and removal of Cdc6
Reactome : CDT1 association with the CDC6:ORC:origin complex
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cross-presentation of soluble exogenous antigens (endosomes)
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : Disease
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : ER-Phagosome pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : M Phase
Reactome : M/G1 Transition
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of mRNA
Reactome : Mitotic Anaphase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Orc1 removal from chromatin
Reactome : PCP/CE pathway
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of Apoptosis
Reactome : Regulation of DNA replication
Reactome : Regulation of activated PAK-2p34 by proteasome mediated degradation
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Regulation of mitotic cell cycle
Reactome : Regulation of ornithine decarboxylase (ODC)
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : SCF-beta-TrCP mediated degradation of Emi1
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Stabilization of p53
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : TCF dependent signaling in response to WNT
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
Reactome : Vif-mediated degradation of APOBEC3G
Reactome : Vpu mediated degradation of CD4
Reactome : beta-catenin independent WNT signaling
Reactome : degradation of AXIN
Reactome : degradation of DVL
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint

Protein

HPRD : 17919

Clone

Cloning Information : 574985

Organism


TAX_ID : 9606
Species Specific ID: 9491

Genome

Chromosome : 20
Map Location : 20p13
Ensembl : ENSG00000125818

Reagents

Labome : PSMF1-antibody