DNASU Plasmid Repository • 480.965.5697 | Email

RB1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RB1
Gene Name:  retinoblastoma 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH178099.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00040526

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2787nts         Open reading frame : 1 to 2787
Reference Sequence Alignment

ATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGGAACCC
CCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAGGACCCAGAGCAGGACAGCGGCCCGGAG
GACCTGCCTCTCGTCAGGCTTGAGTTTGAAGAAACAGAAGAACCTGATTTTACTGCATTA
TGTCAGAAATTAAAGATACCAGATCATGTCAGAGAGAGAGCTTGGTTAACTTGGGAGAAA
GTTTCATCTGTGGATGGAGTATTGGGAGGTTATATTCAAAAGAAAAAGGAACTGTGGGGA
ATCTGTATCTTTATTGCAGCAGTTGACCTAGATGAGATGTCGTTCACTTTTACTGAGCTA
CAGAAAAACATAGAAATCAGTGTCCATAAATTCTTTAACTTACTAAAAGAAATTGATACC
AGTACCAAAGTTGATAATGCTATGTCAAGACTGTTGAAGAAGTATGATGTATTGTTTGCA
CTCTTCAGCAAATTGGAAAGGACATGTGAACTTATATATTTGACACAACCCAGCAGTTCG
ATATCTACTGAAATAAATTCTGCATTGGTGCTAAAAGTTTCTTGGATCACATTTTTATTA
GCTAAAGGGGAAGTATTACAAATGGAAGATGATCTGGTGATTTCATTTCAGTTAATGCTA
TGTGTCCTTGACTATTTTATTAAACTCTCACCTCCCATGTTGCTCAAAGAACCATATAAA
ACAGCTGTTATACCCATTAATGGTTCACCTCGAACACCCAGGCGAGGTCAGAACAGGAGT
GCACGGATAGCAAAACAACTAGAAAATGATACAAGAATTATTGAAGTTCTCTGTAAAGAA
CATGAATGTAATATAGATGAGGTGAAAAATGTTTATTTCAAAAATTTTATACCTTTTATG
AATTCTCTTGGACTTGTAACATCTAATGGACTTCCAGAGGTTGAAAATCTTTCTAAACGA
TACGAAGAAATTTATCTTAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGAT
AAAACTCTTCAGACTGATTCTATAGACAGTTTTGAAACACAGAGAACACCACGAAAAAGT
AACCTTGATGAAGAGGTGAATGTAATTCCTCCACACACTCCAGTTAGGACTGTTATGAAC
ACTATCCAACAATTAATGATGATTTTAAATTCAGCAAGTGATCAACCTTCAGAAAATCTG
ATTTCCTATTTTAACAACTGCACAGTGAATCCAAAAGAAAGTATACTGAAAAGAGTGAAG
GATATAGGATACATCTTTAAAGAGAAATTTGCTAAAGCTGTGGGACAGGGTTGTGTCGAA
ATTGGATCACAGCGATACAAACTTGGAGTTCGCTTGTATTACCGAGTAATGGAATCCATG
CTTAAATCAGAAGAAGAACGATTATCCATTCAAAATTTTAGCAAACTTCTGAATGACAAC
ATTTTTCATATGTCTTTATTGGCGTGCGCTCTTGAGGTTGTAATGGCCACATATAGCAGA
AGTACATCTCAGAATCTTGATTCTGGAACAGATTTGTCTTTCCCATGGATTCTGAATGTG
CTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATCGAAAGTTTTATCAAAGCAGAAGGC
AACTTGACAAGAGAAATGATAAAACATTTAGAACGATGTGAACATCGAATCATGGAATCC
CTTGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAA
GGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCAC
ACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACG
CGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAG
CCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTC
CGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATC
TGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTG
GACCAAATTATGATGTGTTCCATGTATGGCATATGCAAAGTGAAGAATATAGACCTTAAA
TTCAAAATCATTGTAACAGCATACAAGGATCTTCCTCATGCTGTTCAGGAGACATTCAAA
CGTGTTTTGATCAAAGAAGAGGAGTATGATTCTATTATAGTATTCTATAACTCGGTCTTC
ATGCAGAGACTGAAAACAAATATTTTGCAGTATGCTTCCACCAGGCCCCCTACCTTGTCA
CCAATACCTCACATTCCTCGAAGCCCTTACAAGTTTCCTAGTTCACCCTTACGGATTCCT
GGAGGGAACATCTATATTTCACCCCTGAAGAGTCCATATAAAATTTCAGAAGGTCTGCCA
ACACCAACAAAAATGACTCCAAGATCAAGAATCTTAGTATCAATTGGTGAATCATTCGGG
ACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAACAGCGACCGTGTGCTCAAA
AGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTACGCTTTGATATTGAA
GGATCAGATGAAGCAGATGGAAGTAAACATCTCCCAGGAGAGTCCAAATTTCAGCAGAAA
CTGGCAGAAATGACTTCTACTCGAACACGAATGCAAAAGCAGAAAATGAATGATAGCATG
GATACCTCAAACAAGGAAGAGAAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2939
Start on reference sequence 153
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RB1
Symbol Nomenclature : RB1
SYNONYM : OSRC; RB; p105-Rb; pRb; pp110
Designation : prepro-retinoblastoma-associated protein|retinoblastoma suspectibility protein|retinoblastoma-associated protein
Full Nomenclature : retinoblastoma 1
GENEID : 5925
Locus Tag : RP11-174I10.1
HGNC : 9884
MIM : 614041
Vega : OTTHUMG00000016900
Target GenBank: BC039060

 

Reference Sequence Alignment

  

HsCD00040526      ATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGGAACCC
NM_000321.2       ATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGGAACCC
                  ************************************************************

HsCD00040526      CCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAGGACCCAGAGCAGGACAGCGGCCCGGAG
NM_000321.2       CCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAGGACCCAGAGCAGGACAGCGGCCCGGAG
                  ************************************************************

HsCD00040526      GACCTGCCTCTCGTCAGGCTTGAGTTTGAAGAAACAGAAGAACCTGATTTTACTGCATTA
NM_000321.2       GACCTGCCTCTCGTCAGGCTTGAGTTTGAAGAAACAGAAGAACCTGATTTTACTGCATTA
                  ************************************************************

HsCD00040526      TGTCAGAAATTAAAGATACCAGATCATGTCAGAGAGAGAGCTTGGTTAACTTGGGAGAAA
NM_000321.2       TGTCAGAAATTAAAGATACCAGATCATGTCAGAGAGAGAGCTTGGTTAACTTGGGAGAAA
                  ************************************************************

HsCD00040526      GTTTCATCTGTGGATGGAGTATTGGGAGGTTATATTCAAAAGAAAAAGGAACTGTGGGGA
NM_000321.2       GTTTCATCTGTGGATGGAGTATTGGGAGGTTATATTCAAAAGAAAAAGGAACTGTGGGGA
                  ************************************************************

HsCD00040526      ATCTGTATCTTTATTGCAGCAGTTGACCTAGATGAGATGTCGTTCACTTTTACTGAGCTA
NM_000321.2       ATCTGTATCTTTATTGCAGCAGTTGACCTAGATGAGATGTCGTTCACTTTTACTGAGCTA
                  ************************************************************

HsCD00040526      CAGAAAAACATAGAAATCAGTGTCCATAAATTCTTTAACTTACTAAAAGAAATTGATACC
NM_000321.2       CAGAAAAACATAGAAATCAGTGTCCATAAATTCTTTAACTTACTAAAAGAAATTGATACC
                  ************************************************************

HsCD00040526      AGTACCAAAGTTGATAATGCTATGTCAAGACTGTTGAAGAAGTATGATGTATTGTTTGCA
NM_000321.2       AGTACCAAAGTTGATAATGCTATGTCAAGACTGTTGAAGAAGTATGATGTATTGTTTGCA
                  ************************************************************

HsCD00040526      CTCTTCAGCAAATTGGAAAGGACATGTGAACTTATATATTTGACACAACCCAGCAGTTCG
NM_000321.2       CTCTTCAGCAAATTGGAAAGGACATGTGAACTTATATATTTGACACAACCCAGCAGTTCG
                  ************************************************************

HsCD00040526      ATATCTACTGAAATAAATTCTGCATTGGTGCTAAAAGTTTCTTGGATCACATTTTTATTA
NM_000321.2       ATATCTACTGAAATAAATTCTGCATTGGTGCTAAAAGTTTCTTGGATCACATTTTTATTA
                  ************************************************************

HsCD00040526      GCTAAAGGGGAAGTATTACAAATGGAAGATGATCTGGTGATTTCATTTCAGTTAATGCTA
NM_000321.2       GCTAAAGGGGAAGTATTACAAATGGAAGATGATCTGGTGATTTCATTTCAGTTAATGCTA
                  ************************************************************

HsCD00040526      TGTGTCCTTGACTATTTTATTAAACTCTCACCTCCCATGTTGCTCAAAGAACCATATAAA
NM_000321.2       TGTGTCCTTGACTATTTTATTAAACTCTCACCTCCCATGTTGCTCAAAGAACCATATAAA
                  ************************************************************

HsCD00040526      ACAGCTGTTATACCCATTAATGGTTCACCTCGAACACCCAGGCGAGGTCAGAACAGGAGT
NM_000321.2       ACAGCTGTTATACCCATTAATGGTTCACCTCGAACACCCAGGCGAGGTCAGAACAGGAGT
                  ************************************************************

HsCD00040526      GCACGGATAGCAAAACAACTAGAAAATGATACAAGAATTATTGAAGTTCTCTGTAAAGAA
NM_000321.2       GCACGGATAGCAAAACAACTAGAAAATGATACAAGAATTATTGAAGTTCTCTGTAAAGAA
                  ************************************************************

HsCD00040526      CATGAATGTAATATAGATGAGGTGAAAAATGTTTATTTCAAAAATTTTATACCTTTTATG
NM_000321.2       CATGAATGTAATATAGATGAGGTGAAAAATGTTTATTTCAAAAATTTTATACCTTTTATG
                  ************************************************************

HsCD00040526      AATTCTCTTGGACTTGTAACATCTAATGGACTTCCAGAGGTTGAAAATCTTTCTAAACGA
NM_000321.2       AATTCTCTTGGACTTGTAACATCTAATGGACTTCCAGAGGTTGAAAATCTTTCTAAACGA
                  ************************************************************

HsCD00040526      TACGAAGAAATTTATCTTAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGAT
NM_000321.2       TACGAAGAAATTTATCTTAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGAT
                  ************************************************************

HsCD00040526      AAAACTCTTCAGACTGATTCTATAGACAGTTTTGAAACACAGAGAACACCACGAAAAAGT
NM_000321.2       AAAACTCTTCAGACTGATTCTATAGACAGTTTTGAAACACAGAGAACACCACGAAAAAGT
                  ************************************************************

HsCD00040526      AACCTTGATGAAGAGGTGAATGTAATTCCTCCACACACTCCAGTTAGGACTGTTATGAAC
NM_000321.2       AACCTTGATGAAGAGGTGAATGTAATTCCTCCACACACTCCAGTTAGGACTGTTATGAAC
                  ************************************************************

HsCD00040526      ACTATCCAACAATTAATGATGATTTTAAATTCAGCAAGTGATCAACCTTCAGAAAATCTG
NM_000321.2       ACTATCCAACAATTAATGATGATTTTAAATTCAGCAAGTGATCAACCTTCAGAAAATCTG
                  ************************************************************

HsCD00040526      ATTTCCTATTTTAACAACTGCACAGTGAATCCAAAAGAAAGTATACTGAAAAGAGTGAAG
NM_000321.2       ATTTCCTATTTTAACAACTGCACAGTGAATCCAAAAGAAAGTATACTGAAAAGAGTGAAG
                  ************************************************************

HsCD00040526      GATATAGGATACATCTTTAAAGAGAAATTTGCTAAAGCTGTGGGACAGGGTTGTGTCGAA
NM_000321.2       GATATAGGATACATCTTTAAAGAGAAATTTGCTAAAGCTGTGGGACAGGGTTGTGTCGAA
                  ************************************************************

HsCD00040526      ATTGGATCACAGCGATACAAACTTGGAGTTCGCTTGTATTACCGAGTAATGGAATCCATG
NM_000321.2       ATTGGATCACAGCGATACAAACTTGGAGTTCGCTTGTATTACCGAGTAATGGAATCCATG
                  ************************************************************

HsCD00040526      CTTAAATCAGAAGAAGAACGATTATCCATTCAAAATTTTAGCAAACTTCTGAATGACAAC
NM_000321.2       CTTAAATCAGAAGAAGAACGATTATCCATTCAAAATTTTAGCAAACTTCTGAATGACAAC
                  ************************************************************

HsCD00040526      ATTTTTCATATGTCTTTATTGGCGTGCGCTCTTGAGGTTGTAATGGCCACATATAGCAGA
NM_000321.2       ATTTTTCATATGTCTTTATTGGCGTGCGCTCTTGAGGTTGTAATGGCCACATATAGCAGA
                  ************************************************************

HsCD00040526      AGTACATCTCAGAATCTTGATTCTGGAACAGATTTGTCTTTCCCATGGATTCTGAATGTG
NM_000321.2       AGTACATCTCAGAATCTTGATTCTGGAACAGATTTGTCTTTCCCATGGATTCTGAATGTG
                  ************************************************************

HsCD00040526      CTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATCGAAAGTTTTATCAAAGCAGAAGGC
NM_000321.2       CTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATCGAAAGTTTTATCAAAGCAGAAGGC
                  ************************************************************

HsCD00040526      AACTTGACAAGAGAAATGATAAAACATTTAGAACGATGTGAACATCGAATCATGGAATCC
NM_000321.2       AACTTGACAAGAGAAATGATAAAACATTTAGAACGATGTGAACATCGAATCATGGAATCC
                  ************************************************************

HsCD00040526      CTTGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAA
NM_000321.2       CTTGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAA
                  ************************************************************

HsCD00040526      GGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCAC
NM_000321.2       GGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCAC
                  ************************************************************

HsCD00040526      ACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACG
NM_000321.2       ACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACG
                  ************************************************************

HsCD00040526      CGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAG
NM_000321.2       CGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAG
                  ************************************************************

HsCD00040526      CCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTC
NM_000321.2       CCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTC
                  ************************************************************

HsCD00040526      CGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATC
NM_000321.2       CGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATC
                  ************************************************************

HsCD00040526      TGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTG
NM_000321.2       TGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTG
                  ************************************************************

HsCD00040526      GACCAAATTATGATGTGTTCCATGTATGGCATATGCAAAGTGAAGAATATAGACCTTAAA
NM_000321.2       GACCAAATTATGATGTGTTCCATGTATGGCATATGCAAAGTGAAGAATATAGACCTTAAA
                  ************************************************************

HsCD00040526      TTCAAAATCATTGTAACAGCATACAAGGATCTTCCTCATGCTGTTCAGGAGACATTCAAA
NM_000321.2       TTCAAAATCATTGTAACAGCATACAAGGATCTTCCTCATGCTGTTCAGGAGACATTCAAA
                  ************************************************************

HsCD00040526      CGTGTTTTGATCAAAGAAGAGGAGTATGATTCTATTATAGTATTCTATAACTCGGTCTTC
NM_000321.2       CGTGTTTTGATCAAAGAAGAGGAGTATGATTCTATTATAGTATTCTATAACTCGGTCTTC
                  ************************************************************

HsCD00040526      ATGCAGAGACTGAAAACAAATATTTTGCAGTATGCTTCCACCAGGCCCCCTACCTTGTCA
NM_000321.2       ATGCAGAGACTGAAAACAAATATTTTGCAGTATGCTTCCACCAGGCCCCCTACCTTGTCA
                  ************************************************************

HsCD00040526      CCAATACCTCACATTCCTCGAAGCCCTTACAAGTTTCCTAGTTCACCCTTACGGATTCCT
NM_000321.2       CCAATACCTCACATTCCTCGAAGCCCTTACAAGTTTCCTAGTTCACCCTTACGGATTCCT
                  ************************************************************

HsCD00040526      GGAGGGAACATCTATATTTCACCCCTGAAGAGTCCATATAAAATTTCAGAAGGTCTGCCA
NM_000321.2       GGAGGGAACATCTATATTTCACCCCTGAAGAGTCCATATAAAATTTCAGAAGGTCTGCCA
                  ************************************************************

HsCD00040526      ACACCAACAAAAATGACTCCAAGATCAAGAATCTTAGTATCAATTGGTGAATCATTCGGG
NM_000321.2       ACACCAACAAAAATGACTCCAAGATCAAGAATCTTAGTATCAATTGGTGAATCATTCGGG
                  ************************************************************

HsCD00040526      ACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAACAGCGACCGTGTGCTCAAA
NM_000321.2       ACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAACAGCGACCGTGTGCTCAAA
                  ************************************************************

HsCD00040526      AGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTACGCTTTGATATTGAA
NM_000321.2       AGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTACGCTTTGATATTGAA
                  ************************************************************

HsCD00040526      GGATCAGATGAAGCAGATGGAAGTAAACATCTCCCAGGAGAGTCCAAATTTCAGCAGAAA
NM_000321.2       GGATCAGATGAAGCAGATGGAAGTAAACATCTCCCAGGAGAGTCCAAATTTCAGCAGAAA
                  ************************************************************

HsCD00040526      CTGGCAGAAATGACTTCTACTCGAACACGAATGCAAAAGCAGAAAATGAATGATAGCATG
NM_000321.2       CTGGCAGAAATGACTTCTACTCGAACACGAATGCAAAAGCAGAAAATGAATGATAGCATG
                  ************************************************************

HsCD00040526      GATACCTCAAACAAGGAAGAGAAATTG
NM_000321.2       GATACCTCAAACAAGGAAGAGAAATGA
                  ************************* .

Pathways

NCI : ATF-2 transcription factor network
NCI : Ceramide signaling pathway
NCI : Direct p53 effectors
NCI : E2F transcription factor network
NCI : FOXM1 transcription factor network
NCI : Notch-mediated HES/HEY network
NCI : Regulation of retinoblastoma protein
NCI : p73 transcription factor network
Panther : p53 pathway feedback loops 2
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Condensation of Prophase Chromosomes
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Replication
Reactome : E2F mediated regulation of DNA replication
Reactome : Formation of Senescence-Associated Heterochromatin Foci (SAHF)
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : Inhibition of replication initiation of damaged DNA by RB1/E2F1
Reactome : M Phase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : Orc1 removal from chromatin
Reactome : Phosphorylation of proteins involved in G1/S transition by active Cyclin E:Cdk2 complexes
Reactome : Regulation of DNA replication
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
WikiPathway : Adipogenesis
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : Epithelium TarBase
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : G1 to S cell cycle control
WikiPathway : ID signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Senescence and Autophagy
WikiPathway : TSH signaling pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 178099
HIP Master Clone ID : 153244
Original Clone ID : FLH178099.01L

Organism


TAX_ID : 9606
Species Specific ID: 5925

Genome

Chromosome : 13
Map Location : 13q14.2
Ensembl : ENSG00000139687

Reagents

Labome : Rb-antibody