DNASU Plasmid Repository • 480.965.5697 | Email

PMN2A_1233 (P. marinus str. NATL2A ) in pET16-DEST (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PMN2A_1233
Gene Name:  TPR repeat-containing protein
Sequence             
Original Clone ID: BGT41_T01a2
Keyword: partial CDS
Species: Prochlorococcus marinus str. NATL2A
Type: cDNA
Vector Name: pET16-DEST               Format:  CLOSED
Source: Glyco-enzyme clone collection
Description: All clones in the PSI Materials Repository related to human and bacterial glycosylation enzymes (Glyco-enzyme clone collection) were generated through the support of NIH grant RR005351. All users of these clones are requested to cite this grant source on all publications employing these resources
Comments: N-term 6xHis tag and TEV cleavage site
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
Arizona State University
Kelley Moremen
University of Georgia
PmCD00405550

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 1527nts         Open reading frame : 1 to 1527

ACCGAAGAAAGAAAGAATCAAAAGCAAGAAGGCTCTAAAGTAAAAACATTCCCAGTCTCT
TTTGCTTTAGGTGAAATTAAAGAAAACATCACTATTACGACTAATAGCGCTTCTAATACT
TCAAAGGAACAAAAAAGATTTGGAGACCAGAGTAAAACTATAAAGAAAAAAGATACCAAT
ACAATTACTAAACCTTCCAAAGATCAAATCATTAATCAAGCATTTAAATTTCATTCACAA
GGCAATATAAAAGAAGCAGCAAAAAATTATCAATATTTCATTAATCAAGGTTTCTCTGAC
CACATGGTTTTTTCTAATTATGGAGCAATATTAAGAGATCTTGGTAATTTACAAGATGCA
GAATTATATACTCGCAAAGCAATTAAAATTAATCCTAATTACGCATTGGCTTACTCTAAT
CTGGGAAATGTATTAAAAGATCTTGGTAAGTCACAAGATGCAGAATTGTCATACCGCAAA
GCAATTCAAATTAATCCTAATTACGCAGATGCACATTACAATCTGGGAATAATATTGAAA
GAACTTGGTAATTTACAAGACGCAGAATTGTCATATCGCAAAGCAATTCAAATTAATCCT
AATTACGCAGATGCATATTCCAATCTGGGAAATGTATTAAAAGATCTTGATAATTTACAA
GACGCAGAATTGTCATACCGCAAAGCAATTCAAATTAATCCTAGTTACGCAGACGCATAT
TCAAATCTGGGAAATGTATTAAAAGATCTTGGTAATTTACAAGACGCAGAGTTGTCATAC
CGCAAAGCAATTCAAATTAATCCTGATTACGCAGAGGCGCATTTCAATCTAGGAAATCTA
TTAAAAGATCTTGGTAAATTACAAGACGCAGAGTTGTCATATCGCAAAGCAATTCAAATC
AAATCTGATTACGCTGAGGCGCATTACAATCTAGGAATCATATTGAAAGACCTTGGTAAT
TTACAAGACGCAGAATTTTATAATCGCAAAGCAATTCAAATCAAACCTGATTACGCTGAG
GCGCATTTCAATCTGGGAATCATATTGAAAGACCTTGGTAATTTACAAGACGCAGAATTC
TCATATCGCCAAGCAATTCAAATCAAACCTGATTACGCAGATGCCTACTCCAATCTGGGA
AATGTATTAAAAGATCTTGGTAAGTTAAAAGACGCAGAATTGTCATATCGCAAAGCAATT
CAAATCAAACCTGATTACGCTGAGGTTTATTCCAATCTGGGAAATGTATTAAAAGATCTT
GGTAATTTACAAGACGCAGAATTTTCATACCGCAAAGCAATTCAAATCAAACCTGATTAC
GCAGATGCTTACTCCAATCTGGGAAATATATTAAAAGAGCTAAGTAATTTCACTGACGCT
ATAAATCAATTCAAGGATGCACTAAAATTGAACAATGAATTAACATCAGCTCAGACTGGT
TTAATGTCAACTCAGGGTAATATATGCGATTGGAGTGATGAGGAGACTCATAATAAATGG
CTTAAATCACTTGGTATTAAAGGATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET16-DEST

pET16-DEST in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial expression vector with a T7 promoter and a N-terminal 10xHis tag; ampicillin resistance in bacteria; Gateway recombinational cloning.
Comments: None
Size (bp): 7428
Parent Vector: None
Empty Vector: EvNO00548203
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: University of Georgia
Kelley Moremen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
death cassette ccdB ccdB death cassette (removed in clones with the insert) 6626 6931
promoter T7 T7 promoter 5230 5245
protease cleavage site Factor X Factor X protease cleavage site 5365 5376
recombination site attR1 Recombination site 5392 5516
recombination site attR2 recombination site 6972 7096
repressor protein gene LacI Lac repressor coding sequence 3761 4720
selectable marker CmR chloramphenicol resistance (removed in clones with the insert) 5625 6284
selectable marker AmpR ampicillin resistance gene 209 1843
tag His N-terminal 10xHis tag 5323 5352
trxn regulatory element lac operator lac operator 5249 5273
trxn termination sequence T7 term T7 terminator 7155 7216

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Reagents

Gene

 

Gene Symbol : PMN2A_1233
GENEID : 3606626
Locus Tag : PMN2A_1233
Target GenBank: NC_007335.2

 

Protein

Protein GenBank Accession : YP_292426
SMART domain : TPR : Tetratricopeptide repeats
UniProt : Q46IF5

Clone

Cloning Information : 581834
Original Clone ID : BGT41_T01a2

Organism


TAX_ID : 59920
Species Specific ID: 3606626

Reagents

Labome : PMN2A_1233-cDNA