DNASU Plasmid Repository • 480.965.5697 | Email

ORC2L (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ORC2
Gene Name:  origin recognition complex, subunit 2
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH178395.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00040557

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1734nts         Open reading frame : 1 to 1734
Reference Sequence Alignment

ATGAGTAAACCAGAATTAAAGGAAGACAAGATGCTGGAGGTTCACTTTGTGGGAGATGAT
GATGTTCTTAATCACATTCTAGATAGAGAAGGAGGAGCTAAATTGAAGAAGGAGCGAGCG
CAGCTTTTGGTCAACCCCAAAAAAATAATAAAGAAGCCAGAATATGATTTGGAGGAAGAT
GACCAGGAGGTCTTAAAAGATCAGAACTATGTGGAAATTATGGGAAGAGATGTTCAAGAA
TCATTGAAAAATGGCTCTGCTACAGGTGGTGGAAATAAAGTTTATTCTTTTCAGAATAGA
AAACACTCTGAAAAGATGGCTAAATTAGCTTCAGAACTAGCAAAAACACCACAAAAAAGT
GTTTCATTCAGTTTGAAGAATGATCCTGAGATTACGATAAACGTTCCTCAAAGTAGCAAG
GGCCATTCTGCTTCAGACAAGGTTCAACCGAAGAACAATGACAAAAGTGAATTTCTGTCA
ACAGCACCTCGTAGTCTAAGAAAAAGATTAATAGTTCCAAGGTCTCATTCTGACAGTGAA
AGCGAATATTCTGCTTCCAACTCAGAGGATGATGAAGGGGTTGCACAGGAACATGAAGAG
GACACTAATGCAGTCATATTCAGCCAAAAGATTCAAGCTCAGAATAGAGTAGTTTCAGCT
CCTGTTGGCAAAGAAACACCTTCTAAGAGAATGAAAAGAGATAAAACAAGTGACTTAGTA
GAAGAATATTTTGAAGCTCACAGCAGTTCAAAAGTTTTAACCTCTGATAGAACACTGCAG
AAGCTAAAGAGAGCTAAACTGGATCAGCAAACTTTGCGTAACTTATTGAGCAAGGTTTCC
CCTTCCTTTTCTGCCGAACTTAAACAACTAAATCAACAGTATGAAAAATTATTTCATAAA
TGGATGCTGCAATTACACCTTGGGTTCAACATTGTGCTTTATGGTTTGGGTTCTAAGAGA
GATTTACTAGAAAGGTTTCGAACCACTATGCTGCAAGATTCCATTCACGTTGTCATCAAT
GGCTTCTTTCCTGGAATCAGTGTGAAATCAGTCCTGAATTCTATAACAGAAGAAGTCCTC
GATCATATGGGTACTTTCCGCAGTATACTGGATCAGCTAGACTGGATAGTAAACAAATTT
AAAGAAGATTCTTCTTTAGAACTCTTCCTTCTTATCCACAATTTGGATAGCCAGATGTTG
AGAGGAGAGAAGAGCCAGCAAATCATTGGTCAGTTGTCATCTTTGCATAACATTTACCTT
ATAGCATCCATTGACCACCTCAATGCTCCTCTCATGTGGGATCATGCAAAGCAGAGTCTT
TTTAACTGGCTCTGGTATGAAACTACTACATACAGTCCTTATACTGAAGAAACCTCCTAT
GAGAACTCTCTTCTGGTAAAGCAGTCTGGATCCCTGCCACTTAGCTCCCTTACTCATGTC
TTACGAAGCCTTACCCCTAATGCAAGGGGAATTTTCAGGCTACTAATAAAATACCAGCTG
GACAACCAGGATAACCCTTCTTACATTGGCCTTTCTTTTCAAGATTTTTACCAGCAGTGT
CGGGAGGCATTCCTCGTCAATAGTGATCTGACACTCCGGGCCCAGTTAACTGAATTTAGG
GACCACAAGCTTATAAGAACAAAGAAGGGAACTGATGGAGTAGAGTATTTATTAATTCCT
GTTGATAATGGAACATTGACTGATTTCTTGGAAAAGGAAGAAGAGGAGGCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1948
Start on reference sequence 215
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ORC2
Symbol Nomenclature : ORC2
SYNONYM : ORC2L
Designation : origin recognition complex protein 2 homolog|origin recognition complex subunit 2|origin recognition complex, subunit 2 homolog
Full Nomenclature : origin recognition complex, subunit 2
GENEID : 4999
HGNC : 8488
MIM : 601182
Target GenBank: BC014834

 

Reference Sequence Alignment

  

HsCD00040557      ATGAGTAAACCAGAATTAAAGGAAGACAAGATGCTGGAGGTTCACTTTGTGGGAGATGAT
NM_006190.4       ATGAGTAAACCAGAATTAAAGGAAGACAAGATGCTGGAGGTTCACTTTGTGGGAGATGAT
                  ************************************************************

HsCD00040557      GATGTTCTTAATCACATTCTAGATAGAGAAGGAGGAGCTAAATTGAAGAAGGAGCGAGCG
NM_006190.4       GATGTTCTTAATCACATTCTAGATAGAGAAGGAGGAGCTAAATTGAAGAAGGAGCGAGCG
                  ************************************************************

HsCD00040557      CAGCTTTTGGTCAACCCCAAAAAAATAATAAAGAAGCCAGAATATGATTTGGAGGAAGAT
NM_006190.4       CAGCTTTTGGTCAACCCCAAAAAAATAATAAAGAAGCCAGAATATGATTTGGAGGAAGAT
                  ************************************************************

HsCD00040557      GACCAGGAGGTCTTAAAAGATCAGAACTATGTGGAAATTATGGGAAGAGATGTTCAAGAA
NM_006190.4       GACCAGGAGGTCTTAAAAGATCAGAACTATGTGGAAATTATGGGAAGAGATGTTCAAGAA
                  ************************************************************

HsCD00040557      TCATTGAAAAATGGCTCTGCTACAGGTGGTGGAAATAAAGTTTATTCTTTTCAGAATAGA
NM_006190.4       TCATTGAAAAATGGCTCTGCTACAGGTGGTGGAAATAAAGTTTATTCTTTTCAGAATAGA
                  ************************************************************

HsCD00040557      AAACACTCTGAAAAGATGGCTAAATTAGCTTCAGAACTAGCAAAAACACCACAAAAAAGT
NM_006190.4       AAACACTCTGAAAAGATGGCTAAATTAGCTTCAGAACTAGCAAAAACACCACAAAAAAGT
                  ************************************************************

HsCD00040557      GTTTCATTCAGTTTGAAGAATGATCCTGAGATTACGATAAACGTTCCTCAAAGTAGCAAG
NM_006190.4       GTTTCATTCAGTTTGAAGAATGATCCTGAGATTACGATAAACGTTCCTCAAAGTAGCAAG
                  ************************************************************

HsCD00040557      GGCCATTCTGCTTCAGACAAGGTTCAACCGAAGAACAATGACAAAAGTGAATTTCTGTCA
NM_006190.4       GGCCATTCTGCTTCAGACAAGGTTCAACCGAAGAACAATGACAAAAGTGAATTTCTGTCA
                  ************************************************************

HsCD00040557      ACAGCACCTCGTAGTCTAAGAAAAAGATTAATAGTTCCAAGGTCTCATTCTGACAGTGAA
NM_006190.4       ACAGCACCTCGTAGTCTAAGAAAAAGATTAATAGTTCCAAGGTCTCATTCTGACAGTGAA
                  ************************************************************

HsCD00040557      AGCGAATATTCTGCTTCCAACTCAGAGGATGATGAAGGGGTTGCACAGGAACATGAAGAG
NM_006190.4       AGCGAATATTCTGCTTCCAACTCAGAGGATGATGAAGGGGTTGCACAGGAACATGAAGAG
                  ************************************************************

HsCD00040557      GACACTAATGCAGTCATATTCAGCCAAAAGATTCAAGCTCAGAATAGAGTAGTTTCAGCT
NM_006190.4       GACACTAATGCAGTCATATTCAGCCAAAAGATTCAAGCTCAGAATAGAGTAGTTTCAGCT
                  ************************************************************

HsCD00040557      CCTGTTGGCAAAGAAACACCTTCTAAGAGAATGAAAAGAGATAAAACAAGTGACTTAGTA
NM_006190.4       CCTGTTGGCAAAGAAACACCTTCTAAGAGAATGAAAAGAGATAAAACAAGTGACTTAGTA
                  ************************************************************

HsCD00040557      GAAGAATATTTTGAAGCTCACAGCAGTTCAAAAGTTTTAACCTCTGATAGAACACTGCAG
NM_006190.4       GAAGAATATTTTGAAGCTCACAGCAGTTCAAAAGTTTTAACCTCTGATAGAACACTGCAG
                  ************************************************************

HsCD00040557      AAGCTAAAGAGAGCTAAACTGGATCAGCAAACTTTGCGTAACTTATTGAGCAAGGTTTCC
NM_006190.4       AAGCTAAAGAGAGCTAAACTGGATCAGCAAACTTTGCGTAACTTATTGAGCAAGGTTTCC
                  ************************************************************

HsCD00040557      CCTTCCTTTTCTGCCGAACTTAAACAACTAAATCAACAGTATGAAAAATTATTTCATAAA
NM_006190.4       CCTTCCTTTTCTGCCGAACTTAAACAACTAAATCAACAGTATGAAAAATTATTTCATAAA
                  ************************************************************

HsCD00040557      TGGATGCTGCAATTACACCTTGGGTTCAACATTGTGCTTTATGGTTTGGGTTCTAAGAGA
NM_006190.4       TGGATGCTGCAATTACACCTTGGGTTCAACATTGTGCTTTATGGTTTGGGTTCTAAGAGA
                  ************************************************************

HsCD00040557      GATTTACTAGAAAGGTTTCGAACCACTATGCTGCAAGATTCCATTCACGTTGTCATCAAT
NM_006190.4       GATTTACTAGAAAGGTTTCGAACCACTATGCTGCAAGATTCCATTCACGTTGTCATCAAT
                  ************************************************************

HsCD00040557      GGCTTCTTTCCTGGAATCAGTGTGAAATCAGTCCTGAATTCTATAACAGAAGAAGTCCTC
NM_006190.4       GGCTTCTTTCCTGGAATCAGTGTGAAATCAGTCCTGAATTCTATAACAGAAGAAGTCCTC
                  ************************************************************

HsCD00040557      GATCATATGGGTACTTTCCGCAGTATACTGGATCAGCTAGACTGGATAGTAAACAAATTT
NM_006190.4       GATCATATGGGTACTTTCCGCAGTATACTGGATCAGCTAGACTGGATAGTAAACAAATTT
                  ************************************************************

HsCD00040557      AAAGAAGATTCTTCTTTAGAACTCTTCCTTCTTATCCACAATTTGGATAGCCAGATGTTG
NM_006190.4       AAAGAAGATTCTTCTTTAGAACTCTTCCTTCTCATCCACAATTTGGATAGCCAGATGTTG
                  ******************************** ***************************

HsCD00040557      AGAGGAGAGAAGAGCCAGCAAATCATTGGTCAGTTGTCATCTTTGCATAACATTTACCTT
NM_006190.4       AGAGGAGAGAAGAGCCAGCAAATCATTGGTCAGTTGTCATCTTTGCATAACATTTACCTT
                  ************************************************************

HsCD00040557      ATAGCATCCATTGACCACCTCAATGCTCCTCTCATGTGGGATCATGCAAAGCAGAGTCTT
NM_006190.4       ATAGCATCCATTGACCACCTCAATGCTCCTCTCATGTGGGATCATGCAAAGCAGAGTCTT
                  ************************************************************

HsCD00040557      TTTAACTGGCTCTGGTATGAAACTACTACATACAGTCCTTATACTGAAGAAACCTCCTAT
NM_006190.4       TTTAACTGGCTCTGGTATGAAACTACTACATACAGTCCTTATACTGAAGAAACCTCCTAT
                  ************************************************************

HsCD00040557      GAGAACTCTCTTCTGGTAAAGCAGTCTGGATCCCTGCCACTTAGCTCCCTTACTCATGTC
NM_006190.4       GAGAACTCTCTTCTGGTAAAGCAGTCTGGATCCCTGCCACTTAGCTCCCTTACTCATGTC
                  ************************************************************

HsCD00040557      TTACGAAGCCTTACCCCTAATGCAAGGGGAATTTTCAGGCTACTAATAAAATACCAGCTG
NM_006190.4       TTACGAAGCCTTACCCCTAATGCAAGGGGAATTTTCAGGCTACTAATAAAATACCAGCTG
                  ************************************************************

HsCD00040557      GACAACCAGGATAACCCTTCTTACATTGGCCTTTCTTTTCAAGATTTTTACCAGCAGTGT
NM_006190.4       GACAACCAGGATAACCCTTCTTACATTGGCCTTTCTTTTCAAGATTTTTACCAGCAGTGT
                  ************************************************************

HsCD00040557      CGGGAGGCATTCCTCGTCAATAGTGATCTGACACTCCGGGCCCAGTTAACTGAATTTAGG
NM_006190.4       CGGGAGGCATTCCTCGTCAATAGTGATCTGACACTCCGGGCCCAGTTAACTGAATTTAGG
                  ************************************************************

HsCD00040557      GACCACAAGCTTATAAGAACAAAGAAGGGAACTGATGGAGTAGAGTATTTATTAATTCCT
NM_006190.4       GACCACAAGCTTATAAGAACAAAGAAGGGAACTGATGGAGTAGAGTATTTATTAATTCCT
                  ************************************************************

HsCD00040557      GTTGATAATGGAACATTGACTGATTTCTTGGAAAAGGAAGAAGAGGAGGCTTTG
NM_006190.4       GTTGATAATGGAACATTGACTGATTTCTTGGAAAAGGAAGAAGAGGAGGCTTGA
                  **************************************************** .

Pathways

Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the ORC complex at the origin of replication
Reactome : Assembly of the pre-replicative complex
Reactome : Association of licensing factors with the pre-replicative complex
Reactome : CDC6 association with the ORC:origin complex
Reactome : CDT1 association with the CDC6:ORC:origin complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : E2F mediated regulation of DNA replication
Reactome : E2F-enabled inhibition of pre-replication complex formation
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : M/G1 Transition
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Orc1 removal from chromatin
Reactome : Regulation of DNA replication
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
WikiPathway : Cell cycle
WikiPathway : DNA Replication
WikiPathway : G1 to S cell cycle control

Protein

UniProt : Q13416
HPRD : 03112

Clone

Cloning Information : 178395
HIP Master Clone ID : 153496
Original Clone ID : FLH178395.01L

Organism


TAX_ID : 9606
Species Specific ID: 4999

Genome

Chromosome : 2
Map Location : 2q33

Reagents

Labome : ORC2-antibody