DNASU Plasmid Repository • 480.965.5697 | Email

PIK3R3 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3R3
Gene Name:  phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH179924.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00040745

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1386nts         Open reading frame : 1 to 1386
Reference Sequence Alignment

ATGTACAATACGGTGTGGAGTATGGACCGCGATGACGCAGACTGGAGGGAGGTGATGATG
CCCTATTCGACAGAACTGATATTTTATATTGAAATGGATCCTCCAGCTCTTCCACCAAAG
CCACCTAAGCCAATGACTTCAGCAGTTCCAAATGGAATGAAGGACAGTTCTGTTTCTCTT
CAGGATGCAGAATGGTACTGGGGGGATATTTCAAGGGAGGAGGTAAATGACAAATTGCGG
GATATGCCAGATGGGACCTTCTTGGTCCGAGATGCCTCAACAAAAATGCAGGGAGATTAT
ACTTTGACTTTGCGGAAGGGAGGCAATAATAAGTTAATAAAGATCTATCACCGGGATGGT
AAATATGGCTTTTCTGATCCTCTGACATTTAATTCCGTGGTGGAGCTCATTAACCACTAT
CACCATGAATCTCTTGCTCAGTACAATCCCAAACTTGATGTGAAGCTGATGTACCCAGTG
TCCAGATACCAACAGGATCAGTTGGTAAAAGAAGATAATATTGATGCAGTAGGTAAAAAA
CTGCAAGAATACCACTCTCAGTATCAGGAGAAGAGTAAAGAGTATGATAGGCTGTATGAA
GAATATACTAGAACATCCCAGGAAATACAGATGAAGAGGACTGCAATAGAAGCTTTTAAT
GAAACAATTAAAATATTTGAAGAGCAGTGTCACACACAAGAACAACATAGCAAAGAATAT
ATTGAGCGATTTCGCAGAGAGGGGAATGAAAAGGAGATTGAACGAATTATGATGAATTAT
GATAAATTGAAATCACGTCTGGGTGAGATTCATGATAGCAAAATGCGTCTAGAGCAGGAT
TTGAAGAATCAAGCTTTGGACAACCGAGAAATAGATAAAAAAATGAATAGCATCAAACCT
GACCTGATCCAGCTGCGAAAGATCCGAGATCAACACCTTGTATGGCTCAATCACAAAGGA
GTGAGACAGAAACGCCTGAATGTCTGGCTGGGAATTAAGAATGAGGATGCTGCTGAGAAC
TATTTTATCAATGAGGAAGATGAAAACCTGCCCCATTATGATGAGAAAACCTGGTTTGTT
GAGGATATCAATCGAGTACAAGCAGAGGACTTGCTTTATGGGAAACCTGATGGTGCATTC
TTAATTCGTGAGAGTAGCAAGAAAGGATGCTATGCTTGCTCTGTGGTGGCCGATGGGGAA
GTGAAGCACTGTGTGATCTACAGCACTGCTCGGGGCTATGGCTTTGCAGAGCCCTACAAC
CTGTACAGCTCTCTGAAGGAGCTAGTGCTCCATTACCAGCAGACATCCTTGGTTCAGCAC
AACGACTCCCTCAACGTCAGGCTTGCCTACCCTGTTCATGCACAGATGCCCTCGCTTTGC
AGATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2076
Start on reference sequence 691
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3R3
Symbol Nomenclature : PIK3R3
SYNONYM : p55; p55-GAMMA
Designation : 100% homology to SWISS-PROT Q92569|PI3-kinase regulatory subunit gamma|PI3-kinase subunit p55-gamma|PI3K regulatory subunit gamma|p55PIK|phosphatidylinositol 3-kinase 55 kDa regulatory subunit gamma|phosphatidylinositol 3-kinase regulatory subunit gamma|phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 3 (p55, gamma)|phosphoinositide-3-kinase, regulatory subunit 3 (p55, gamma)|phosphoinositide-3-kinase, regulatory subunit, polypeptide 3 (p55, gamma)|ptdIns-3-kinase regulatory subunit gamma|ptdIns-3-kinase regulatory subunit p55-gamma
Full Nomenclature : phosphoinositide-3-kinase, regulatory subunit 3 (gamma)
GENEID : 8503
Locus Tag : RP4-533D7.2
HGNC : 8981
MIM : 606076
Vega : OTTHUMG00000008096
Target GenBank: BC021622

 

Reference Sequence Alignment

  

HsCD00040745        ---------------------------------------------------ATGTACAAT
NM_003629.3         ---------------------------------------------------ATGTACAAT
NM_001114172.1      ---------------------------------------------------ATGTACAAT
XM_005271290.1      ATGCCTGCTGTCCCCCCTCCCGGCGCGGTTGGGTGGCGCCTCAGCGGCGCGATGTACAAT
                                                                       *********

HsCD00040745        ACGGTGTGGAGTATGGACCGCGATGACGCAGACTGGAGGGAGGTGATGATGCCCTATTCG
NM_003629.3         ACGGTGTGGAGTATGGACCGCGATGACGCAGACTGGAGGGAGGTGATGATGCCCTATTCG
NM_001114172.1      ACGGTGTGGAGTATGGACCGCGATGACGCAGACTGGAGGGAGGTGATGATGCCCTATTCG
XM_005271290.1      ACGGTGTGGAGTATGGACCGCGATGACGCAGACTGGAGGGAGGTGATGATGCCCTATTCG
                    ************************************************************

HsCD00040745        ACAGAACTGATATTTTATATTGAAATGGATCCTCCAGCTCTTCCACCAAAGCCACCTAAG
NM_003629.3         ACAGAACTGATATTTTATATTGAAATGGATCCTCCAGCTCTTCCACCAAAGCCACCTAAG
NM_001114172.1      ACAGAACTGATATTTTATATTGAAATGGATCCTCCAGCTCTTCCACCAAAGCCACCTAAG
XM_005271290.1      ACAGAACTGATATTTTATATTGAAATGGATCCTCCAGCTCTTCCACCAAAGCCACCTAAG
                    ************************************************************

HsCD00040745        CCAATGACTTCAGCAGTTCCAAATGGAATGAAGGACAGTTCTGTTTCTCTTCAGGATGCA
NM_003629.3         CCAATGACTTCAGCAGTTCCAAATGGAATGAAGGACAGTTCTGTTTCTCTTCAGGATGCA
NM_001114172.1      CCAATGACTTCAGCAGTTCCAAATGGAATGAAGGACAGTTCTGTTTCTCTTCAGGATGCA
XM_005271290.1      CCAATGACTTCAGCAGTTCCAAATGGAATGAAGGACAGTTCTGTTTCTCTTCAGGATGCA
                    ************************************************************

HsCD00040745        GAATGGTACTGGGGGGATATTTCAAGGGAGGAGGTAAATGACAAATTGCGGGATATGCCA
NM_003629.3         GAATGGTACTGGGGGGATATTTCAAGGGAGGAGGTAAATGACAAATTGCGGGATATGCCA
NM_001114172.1      GAATGGTACTGGGGGGATATTTCAAGGGAGGAGGTAAATGACAAATTGCGGGATATGCCA
XM_005271290.1      GAATGGTACTGGGGGGATATTTCAAGGGAGGAGGTAAATGACAAATTGCGGGATATGCCA
                    ************************************************************

HsCD00040745        GATGGGACCTTCTTGGTCCGAGATGCCTCAACAAAAATGCAGGGAGATTATACTTTGACT
NM_003629.3         GATGGGACCTTCTTGGTCCGAGATGCCTCAACAAAAATGCAGGGAGATTATACTTTGACT
NM_001114172.1      GATGGGACCTTCTTGGTCCGAGATGCCTCAACAAAAATGCAGGGAGATTATACTTTGACT
XM_005271290.1      GATGGGACCTTCTTGGTCCGAGATGCCTCAACAAAAATGCAGGGAGATTATACTTTGACT
                    ************************************************************

HsCD00040745        TTGCGGAAGGGAGGCAATAATAAGTTAATAAAGATCTATCACCGGGATGGTAAATATGGC
NM_003629.3         TTGCGGAAGGGAGGCAATAATAAGTTAATAAAGATCTATCACCGGGATGGTAAATATGGC
NM_001114172.1      TTGCGGAAGGGAGGCAATAATAAGTTAATAAAGATCTATCACCGGGATGGTAAATATGGC
XM_005271290.1      TTGCGGAAGGGAGGCAATAATAAGTTAATAAAGATCTATCACCGGGATGGTAAATATGGC
                    ************************************************************

HsCD00040745        TTTTCTGATCCTCTGACATTTAATTCCGTGGTGGAGCTCATTAACCACTATCACCATGAA
NM_003629.3         TTTTCTGATCCTCTGACATTTAATTCCGTGGTGGAGCTCATTAACCACTATCACCATGAA
NM_001114172.1      TTTTCTGATCCTCTGACATTTAATTCCGTGGTGGAGCTCATTAACCACTATCACCATGAA
XM_005271290.1      TTTTCTGATCCTCTGACATTTAATTCCGTGGTGGAGCTCATTAACCACTATCACCATGAA
                    ************************************************************

HsCD00040745        TCTCTTGCTCAGTACAATCCCAAACTTGATGTGAAGCTGATGTACCCAGTGTCCAGATAC
NM_003629.3         TCTCTTGCTCAGTACAATCCCAAACTTGATGTGAAGCTGATGTACCCAGTGTCCAGATAC
NM_001114172.1      TCTCTTGCTCAGTACAATCCCAAACTTGATGTGAAGCTGATGTACCCAGTGTCCAGATAC
XM_005271290.1      TCTCTTGCTCAGTACAATCCCAAACTTGATGTGAAGCTGATGTACCCAGTGTCCAGATAC
                    ************************************************************

HsCD00040745        CAACAGGATCAGTTGGTAAAAGAAGATAATATTGATGCAGTAGGTAAAAAACTGCAAGAA
NM_003629.3         CAACAGGATCAGTTGGTAAAAGAAGATAATATTGATGCAGTAGGTAAAAAACTGCAAGAA
NM_001114172.1      CAACAGGATCAGTTGGTAAAAGAAGATAATATTGATGCAGTAGGTAAAAAACTGCAAGAA
XM_005271290.1      CAACAGGATCAGTTGGTAAAAGAAGATAATATTGATGCAGTAGGTAAAAAACTGCAAGAA
                    ************************************************************

HsCD00040745        TACCACTCTCAGTATCAGGAGAAGAGTAAAGAGTATGATAGGCTGTATGAAGAATATACT
NM_003629.3         TACCACTCTCAGTATCAGGAGAAGAGTAAAGAGTATGATAGGCTGTATGAAGAATATACT
NM_001114172.1      TACCACTCTCAGTATCAGGAGAAGAGTAAAGAGTATGATAGGCTGTATGAAGAATATACT
XM_005271290.1      TACCACTCTCAGTATCAGGAGAAGAGTAAAGAGTATGATAGGCTGTATGAAGAATATACT
                    ************************************************************

HsCD00040745        AGAACATCCCAGGAAATACAGATGAAGAGGACTGCAATAGAAGCTTTTAATGAAACAATT
NM_003629.3         AGAACATCCCAGGAAATACAGATGAAGAGGACTGCAATAGAAGCTTTTAATGAAACAATT
NM_001114172.1      AGAACATCCCAGGAAATACAGATGAAGAGGACTGCAATAGAAGCTTTTAATGAAACAATT
XM_005271290.1      AGAACATCCCAGGAAATACAGATGAAGAGGACTGCAATAGAAGCTTTTAATGAAACAATT
                    ************************************************************

HsCD00040745        AAAATATTTGAAGAGCAGTGTCACACACAAGAACAACATAGCAAAGAATATATTGAGCGA
NM_003629.3         AAAATATTTGAAGAGCAGTGTCACACACAAGAACAACATAGCAAAGAATATATTGAGCGA
NM_001114172.1      AAAATATTTGAAGAGCAGTGTCACACACAAGAACAACATAGCAAAGAATATATTGAGCGA
XM_005271290.1      AAAATATTTGAAGAGCAGTGTCACACACAAGAACAACATAGCAAAGAATATATTGAGCGA
                    ************************************************************

HsCD00040745        TTTCGCAGAGAGGGGAATGAAAAGGAGATTGAACGAATTATGATGAATTATGATAAATTG
NM_003629.3         TTTCGCAGAGAGGGGAATGAAAAGGAGATTGAACGAATTATGATGAATTATGATAAATTG
NM_001114172.1      TTTCGCAGAGAGGGGAATGAAAAGGAGATTGAACGAATTATGATGAATTATGATAAATTG
XM_005271290.1      TTTCGCAGAGAGGGGAATGAAAAGGAGATTGAACGAATTATGATGAATTATGATAAATTG
                    ************************************************************

HsCD00040745        AAATCACGTCTGGGTGAGATTCATGATAGCAAAATGCGTCTAGAGCAGGATTTGAAGAAT
NM_003629.3         AAATCACGTCTGGGTGAGATTCATGATAGCAAAATGCGTCTAGAGCAGGATTTGAAGAAT
NM_001114172.1      AAATCACGTCTGGGTGAGATTCATGATAGCAAAATGCGTCTAGAGCAGGATTTGAAGAAT
XM_005271290.1      AAATCACGTCTGGGTGAGATTCATGATAGCAAAATGCGTCTAGAGCAGGATTTGAAGAAT
                    ************************************************************

HsCD00040745        CAAGCTTTGGACAACCGAGAAATAGATAAAAAAATGAATAGCATCAAACCTGACCTGATC
NM_003629.3         CAAGCTTTGGACAACCGAGAAATAGATAAAAAAATGAATAGCATCAAACCTGACCTGATC
NM_001114172.1      CAAGCTTTGGACAACCGAGAAATAGATAAAAAAATGAATAGCATCAAACCTGACCTGATC
XM_005271290.1      CAAGCTTTGGACAACCGAGAAATAGATAAAAAAATGAATAGCATCAAACCTGACCTGATC
                    ************************************************************

HsCD00040745        CAGCTGCGAAAGATCCGAGATCAACACCTTGTATGGCTCAATCACAAAGGAGTGAGACAG
NM_003629.3         CAGCTGCGAAAGATCCGAGATCAACACCTTGTATGGCTCAATCACAAAGGAGTGAGACAG
NM_001114172.1      CAGCTGCGAAAGATCCGAGATCAACACCTTGTATGGCTCAATCACAAAGGAGTGAGACAG
XM_005271290.1      CAGCTGCGAAAGATCCGAGATCAACACCTTGTATGGCTCAATCACAAAGGAGTGAGACAG
                    ************************************************************

HsCD00040745        AAACGCCTGAATGTCTGGCTGGGAATTAAGAATGAGGATGCTGCTGAGAACTATTTTATC
NM_003629.3         AAACGCCTGAATGTCTGGCTGGGAATTAAGAATGAGGATGCTGATGAGAACTATTTTATC
NM_001114172.1      AAACGCCTGAATGTCTGGCTGGGAATTAAGAATGAGGATGCTGATGAGAACTATTTTATC
XM_005271290.1      AAACGCCTGAATGTCTGGCTGGGAATTAAGAATGAGGATGCTGATGAGAACTATTTTATC
                    *******************************************.****************

HsCD00040745        AATGAGGAAGATGAAAACCTGCCCCATTATGATGAGAAAACCTGGTTTGTTGAGGATATC
NM_003629.3         AATGAGGAAGATGAAAACCTGCCCCATTATGATGAGAAAACCTGGTTTGTTGAGGATATC
NM_001114172.1      AATGAGGAAGATGAAAACCTGCCCCATTATGATGAGAAAACCTGGTTTGTTGAGGATATC
XM_005271290.1      AATGAGGAAGATGAAAACCTGCCCCATTATGATGAGAAAACCTGGTTTGTTGAGGATATC
                    ************************************************************

HsCD00040745        AATCGAGTACAAGCAGAGGACTTGCTTTATGGGAAACCTGATGGTGCATTCTTAATTCGT
NM_003629.3         AATCGAGTACAAGCAGAGGACTTGCTTTATGGGAAACCTGATGGTGCATTCTTAATTCGT
NM_001114172.1      AATCGAGTACAAGCAGAGGACTTGCTTTATGGGAAACCTGATGGTGCATTCTTAATTCGT
XM_005271290.1      AATCGAGTACAAGCAGAGGACTTGCTTTATGGGAAACCTGATGGTGCATTCTTAATTCGT
                    ************************************************************

HsCD00040745        GAGAGTAGCAAGAAAGGATGCTATGCTTGCTCTGTGGTGGCCGATGGGGAAGTGAAGCAC
NM_003629.3         GAGAGTAGCAAGAAAGGATGCTATGCTTGCTCTGTGGTGGCCGATGGGGAAGTGAAGCAC
NM_001114172.1      GAGAGTAGCAAGAAAGGATGCTATGCTTGCTCTGTGGTGGCCGATGGGGAAGTGAAGCAC
XM_005271290.1      GAGAGTAGCAAGAAAGGATGCTATGCTTGCTCTGTGGTGGCCGATGGGGAAGTGAAGCAC
                    ************************************************************

HsCD00040745        TGTGTGATCTACAGCACTGCTCGGGGCTATGGCTTTGCAGAGCCCTACAACCTGTACAGC
NM_003629.3         TGTGTGATCTACAGCACTGCTCGGGGCTATGGCTTTGCAGAGCCCTACAACCTGTACAGC
NM_001114172.1      TGTGTGATCTACAGCACTGCTCGGGGCTATGGCTTTGCAGAGCCCTACAACCTGTACAGC
XM_005271290.1      TGTGTGATCTACAGCACTGCTCGGGGCTATGGCTTTGCAGAGCCCTACAACCTGTACAGC
                    ************************************************************

HsCD00040745        TCTCTGAAGGAGCTAGTGCTCCATTACCAGCAGACATCCTTGGTTCAGCACAACGACTCC
NM_003629.3         TCTCTGAAGGAGCTAGTGCTCCATTACCAGCAGACATCCTTGGTTCAGCACAACGACTCC
NM_001114172.1      TCTCTGAAGGAGCTAGTGCTCCATTACCAGCAGACATCCTTGGTTCAGCACAACGACTCC
XM_005271290.1      TCTCTGAAGGAGCTAGTGCTCCATTACCAGCAGACATCCTTGGTTCAGCACAACGACTCC
                    ************************************************************

HsCD00040745        CTCAACGTCAGGCTTGCCTACCCTGTTCATGCACAGATGCCCTCGCTTTGCAGATTG
NM_003629.3         CTCAACGTCAGGCTTGCCTACCCTGTTCATGCACAGATGCCCTCGCTTTGCAGATAA
NM_001114172.1      CTCAACGTCAGGCTTGCCTACCCTGTTCATGCACAGATGCCCTCGCTTTGCAGATAA
XM_005271290.1      CTCAACGTCAGGCTTGCCTACCCTGTTCATGCACAGATGCCCTCGCTTTGCAGATAA
                    *******************************************************:.

Pathways

NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FAS (CD95) signaling pathway
NCI : Internalization of ErbB1
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : PDGFR-beta signaling pathway
NCI : Signaling events mediated by TCPTP
NCI : TRAIL signaling pathway
Panther : Angiogenesis
Panther : Axon guidance mediated by netrin
Panther : Endothelin signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Adaptive Immune System
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : G alpha (12/13) signalling events
Reactome : G alpha (q) signalling events
Reactome : GAB1 signalosome
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Interleukin-7 signaling
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipid metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Synthesis of PIPs at the plasma membrane
WikiPathway : AMPK signaling
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : SH2 : Src homology 2 domains
UniProt : Q8N381
UniProt : Q92569
HPRD : 05831

Clone

Cloning Information : 179924
HIP Master Clone ID : 155025
Original Clone ID : FLH179924.01L

Organism


TAX_ID : 9606
Species Specific ID: 8503

Genome

Chromosome : 1
Map Location : 1p34.1
Ensembl : ENSG00000117461

Reagents

Labome : PIK3R3-antibody