DNASU Plasmid Repository • 480.965.5697 | Email

CCND2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCND2
Gene Name:  cyclin D2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH010344.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000410

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 870nts         Open reading frame : 1 to 870
Reference Sequence Alignment

ATGGAGCTGCTGTGCCACGAGGTGGACCCGGTCCGCAGGGCCGTGCGGGACCGCAACCTG
CTCCGAGACGACCGCGTCCTGCAGAACCTGCTCACCATCGAGGAGCGCTACCTTCCGCAG
TGCTCCTACTTCAAGTGCGTGCAGAAGGACATCCAACCCTACATGCGCAGAATGGTGGCC
ACCTGGATGCTGGAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCC
ATGAATTACCTGGACCGTTTCTTGGCTGGGGTCCCGACTCCGAAGTCCCATCTGCAACTC
CTGGGTGCTGTCTGCATGTTCCTGGCCTCCAAACTCAAAGAGACCAGCCCGCTGACCGCG
GAGAAGCTGTGCATTTACACCGACAACTCCATCAAGCCTCAGGAGCTGCTGGAGTGGGAA
CTGGTGGTGCTGGGGAAGTTGAAGTGGAACCTGGCAGCTGTCACTCCTCATGACTTCATT
GAGCACATCTTGCGCAAGCTGCCCCAGCAGCGGGAGAAGCTGTCTCTGATCCGCAAGCAT
GCTCAGACCTTCATTGCTCTGTGTGCCACCGACTTTAAGTTTGCCATGTACCCACCGTCG
ATGATCGCAACTGGAAGTGTGGGAGCAGCCATCTGTGGGCTCCAGCAGGATGAGGAAGTG
AGCTCGCTCACTTGTGATGCCCTGACTGAGCTGCTGGCTAAGATCACCAACACAGACGTG
GATTGTCTCAAAGCTTGCCAGGAGCAGATTGAGGCGGTGCTCCTCAATAGCCTGCAGCAG
TACCGTCAGGACCAACGTGACGGATCCAAGTCGGAGGATGAACTGGACCAAGCCAGCACC
CCTACAGACGTGCGGGATATCGACCTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1139
Start on reference sequence 270
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCND2
Symbol Nomenclature : CCND2
SYNONYM : KIAK0002
Designation : G1/S-specific cyclin D2|G1/S-specific cyclin-D2
Full Nomenclature : cyclin D2
GENEID : 894
GI : 61365645
GenBank Accession : AY890800
HGNC : 1583
MIM : 123833
Vega : OTTHUMG00000168123
Target GenBank: NM_001759

 

Reference Sequence Alignment

  

HsCD00000410      ATGGAGCTGCTGTGCCACGAGGTGGACCCGGTCCGCAGGGCCGTGCGGGACCGCAACCTG
NM_001759.3       ATGGAGCTGCTGTGCCACGAGGTGGACCCGGTCCGCAGGGCCGTGCGGGACCGCAACCTG
                  ************************************************************

HsCD00000410      CTCCGAGACGACCGCGTCCTGCAGAACCTGCTCACCATCGAGGAGCGCTACCTTCCGCAG
NM_001759.3       CTCCGAGACGACCGCGTCCTGCAGAACCTGCTCACCATCGAGGAGCGCTACCTTCCGCAG
                  ************************************************************

HsCD00000410      TGCTCCTACTTCAAGTGCGTGCAGAAGGACATCCAACCCTACATGCGCAGAATGGTGGCC
NM_001759.3       TGCTCCTACTTCAAGTGCGTGCAGAAGGACATCCAACCCTACATGCGCAGAATGGTGGCC
                  ************************************************************

HsCD00000410      ACCTGGATGCTGGAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCC
NM_001759.3       ACCTGGATGCTGGAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCC
                  ************************************************************

HsCD00000410      ATGAATTACCTGGACCGTTTCTTGGCTGGGGTCCCGACTCCGAAGTCCCATCTGCAACTC
NM_001759.3       ATGAATTACCTGGACCGTTTCTTGGCTGGGGTCCCGACTCCGAAGTCCCATCTGCAACTC
                  ************************************************************

HsCD00000410      CTGGGTGCTGTCTGCATGTTCCTGGCCTCCAAACTCAAAGAGACCAGCCCGCTGACCGCG
NM_001759.3       CTGGGTGCTGTCTGCATGTTCCTGGCCTCCAAACTCAAAGAGACCAGCCCGCTGACCGCG
                  ************************************************************

HsCD00000410      GAGAAGCTGTGCATTTACACCGACAACTCCATCAAGCCTCAGGAGCTGCTGGAGTGGGAA
NM_001759.3       GAGAAGCTGTGCATTTACACCGACAACTCCATCAAGCCTCAGGAGCTGCTGGAGTGGGAA
                  ************************************************************

HsCD00000410      CTGGTGGTGCTGGGGAAGTTGAAGTGGAACCTGGCAGCTGTCACTCCTCATGACTTCATT
NM_001759.3       CTGGTGGTGCTGGGGAAGTTGAAGTGGAACCTGGCAGCTGTCACTCCTCATGACTTCATT
                  ************************************************************

HsCD00000410      GAGCACATCTTGCGCAAGCTGCCCCAGCAGCGGGAGAAGCTGTCTCTGATCCGCAAGCAT
NM_001759.3       GAGCACATCTTGCGCAAGCTGCCCCAGCAGCGGGAGAAGCTGTCTCTGATCCGCAAGCAT
                  ************************************************************

HsCD00000410      GCTCAGACCTTCATTGCTCTGTGTGCCACCGACTTTAAGTTTGCCATGTACCCACCGTCG
NM_001759.3       GCTCAGACCTTCATTGCTCTGTGTGCCACCGACTTTAAGTTTGCCATGTACCCACCGTCG
                  ************************************************************

HsCD00000410      ATGATCGCAACTGGAAGTGTGGGAGCAGCCATCTGTGGGCTCCAGCAGGATGAGGAAGTG
NM_001759.3       ATGATCGCAACTGGAAGTGTGGGAGCAGCCATCTGTGGGCTCCAGCAGGATGAGGAAGTG
                  ************************************************************

HsCD00000410      AGCTCGCTCACTTGTGATGCCCTGACTGAGCTGCTGGCTAAGATCACCAACACAGACGTG
NM_001759.3       AGCTCGCTCACTTGTGATGCCCTGACTGAGCTGCTGGCTAAGATCACCAACACAGACGTG
                  ************************************************************

HsCD00000410      GATTGTCTCAAAGCTTGCCAGGAGCAGATTGAGGCGGTGCTCCTCAATAGCCTGCAGCAG
NM_001759.3       GATTGTCTCAAAGCTTGCCAGGAGCAGATTGAGGCGGTGCTCCTCAATAGCCTGCAGCAG
                  ************************************************************

HsCD00000410      TACCGTCAGGACCAACGTGACGGATCCAAGTCGGAGGATGAACTGGACCAAGCCAGCACC
NM_001759.3       TACCGTCAGGACCAACGTGACGGATCCAAGTCGGAGGATGAACTGGACCAAGCCAGCACC
                  ************************************************************

HsCD00000410      CCTACAGACGTGCGGGATATCGACCTGTTG
NM_001759.3       CCTACAGACGTGCGGGATATCGACCTGTGA
                  **************************** .

Pathways

NCI : IL2 signaling events mediated by STAT5
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Regulation of retinoblastoma protein
NCI : Validated targets of C-MYC transcriptional activation
Panther : Cell cycle
Panther : PI3 kinase pathway
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cyclin D associated events in G1
Reactome : G1 Phase
Reactome : Mitotic G1-G1/S phases
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Focal Adhesion
WikiPathway : G1 to S cell cycle control
WikiPathway : IL-2 Signaling pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : SRF and miRs in Smooth Muscle Differentiation and Proliferation
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 10344
HIP Master Clone ID : 14481
Original Clone ID : FLH010344.01L

Organism


TAX_ID : 9606
Species Specific ID: 894

Genome

Chromosome : 12
Map Location : 12p13
Ensembl : ENSG00000118971

Reagents

Labome : cyclin-D2-antibody