DNASU Plasmid Repository • 480.965.5697 | Email

CA7 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CA7
Gene Name:  carbonic anhydrase VII
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH182880.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00041026

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 795nts         Open reading frame : 1 to 795
Reference Sequence Alignment

ATGACCGGCCACCACGGCTGGGGCTACGGCCAGGACGACGGCCCCTCGCATTGGCACAAG
CTGTATCCCATTGCCCAGGGAGATCGCCAATCACCCATCAATATCATCTCCAGCCAGGCT
GTGTACTCTCCCAGCCTGCAACCACTGGAGCTTTCCTATGAGGCCTGCATGTCCCTCAGC
ATCACCAACAATGGCCACTCTGTCCAGGTAGACTTCAATGACAGCGATGACCGAACCGTG
GTGACTGGGGGCCCCCTGGAAGGGCCCTACCGCCTCAAGCAGTTTCACTTCCACTGGGGC
AAGAAGCACGATGTGGGTTCTGAGCACACGGTGGACGGCAAGTCCTTCCCCAGCGAGCTG
CATCTGGTTCACTGGAATGCCAAGAAGTACAGCACTTTTGGGGAGGCGGCCTCAGCACCT
GATGGCCTGGCTGTGGTTGGTGTTTTTTTGGAGACAGGAGACGAGCACCCCAGCATGAAT
CGTCTGACAGATGCGCTCTACATGGTCCGGTTCAAGGGCACCAAAGCCCAGTTCAGCTGC
TTCAACCCCAAGTGCCTCCTGCCTGCCAGCCGGCACTACTGGACCTACCCGGGCTCTCTG
ACGACTCCCCCACTCAGTGAGAGTGTCACCTGGATTGTGCTCCGGGAGCCCATCTGCATC
TCTGAAAGGCAGATGGGGAAGTTCCGGAGCCTGCTTTTTACCTCGGAGGACGATGAGAGG
ATCCACATGGTGAACAACTTCCGGCCACCACAGCCACTGAAGGGCCGCGTGGTAAAGGCC
TCCTTCCGGGCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 860
Start on reference sequence 66
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CA7
Symbol Nomenclature : CA7
SYNONYM : CAVII
Designation : CA-VII|carbonate dehydratase VII|carbonic anhydrase 7|carbonic dehydratase VII
Full Nomenclature : carbonic anhydrase VII
GENEID : 766
HGNC : 1381
MIM : 114770
Vega : OTTHUMG00000137524
Target GenBank: BC033865

 

Reference Sequence Alignment

  

HsCD00041026      ATGACCGGCCACCACGGCTGGGGCTACGGCCAGGACGACGGCCCCTCGCATTGGCACAAG
NM_005182.2       ATGACCGGCCACCACGGCTGGGGCTACGGCCAGGACGACGGCCCCTCGCATTGGCACAAG
                  ************************************************************

HsCD00041026      CTGTATCCCATTGCCCAGGGAGATCGCCAATCACCCATCAATATCATCTCCAGCCAGGCT
NM_005182.2       CTGTATCCCATTGCCCAGGGAGATCGCCAATCACCCATCAATATCATCTCCAGCCAGGCT
                  ************************************************************

HsCD00041026      GTGTACTCTCCCAGCCTGCAACCACTGGAGCTTTCCTATGAGGCCTGCATGTCCCTCAGC
NM_005182.2       GTGTACTCTCCCAGCCTGCAACCACTGGAGCTTTCCTATGAGGCCTGCATGTCCCTCAGC
                  ************************************************************

HsCD00041026      ATCACCAACAATGGCCACTCTGTCCAGGTAGACTTCAATGACAGCGATGACCGAACCGTG
NM_005182.2       ATCACCAACAATGGCCACTCTGTCCAGGTAGACTTCAATGACAGCGATGACCGAACCGTG
                  ************************************************************

HsCD00041026      GTGACTGGGGGCCCCCTGGAAGGGCCCTACCGCCTCAAGCAGTTTCACTTCCACTGGGGC
NM_005182.2       GTGACTGGGGGCCCCCTGGAAGGGCCCTACCGCCTCAAGCAGTTTCACTTCCACTGGGGC
                  ************************************************************

HsCD00041026      AAGAAGCACGATGTGGGTTCTGAGCACACGGTGGACGGCAAGTCCTTCCCCAGCGAGCTG
NM_005182.2       AAGAAGCACGATGTGGGTTCTGAGCACACGGTGGACGGCAAGTCCTTCCCCAGCGAGCTG
                  ************************************************************

HsCD00041026      CATCTGGTTCACTGGAATGCCAAGAAGTACAGCACTTTTGGGGAGGCGGCCTCAGCACCT
NM_005182.2       CATCTGGTTCACTGGAATGCCAAGAAGTACAGCACTTTTGGGGAGGCGGCCTCAGCACCT
                  ************************************************************

HsCD00041026      GATGGCCTGGCTGTGGTTGGTGTTTTTTTGGAGACAGGAGACGAGCACCCCAGCATGAAT
NM_005182.2       GATGGCCTGGCTGTGGTTGGTGTTTTTTTGGAGACAGGAGACGAGCACCCCAGCATGAAT
                  ************************************************************

HsCD00041026      CGTCTGACAGATGCGCTCTACATGGTCCGGTTCAAGGGCACCAAAGCCCAGTTCAGCTGC
NM_005182.2       CGTCTGACAGATGCGCTCTACATGGTCCGGTTCAAGGGCACCAAAGCCCAGTTCAGCTGC
                  ************************************************************

HsCD00041026      TTCAACCCCAAGTGCCTCCTGCCTGCCAGCCGGCACTACTGGACCTACCCGGGCTCTCTG
NM_005182.2       TTCAACCCCAAGTGCCTCCTGCCTGCCAGCCGGCACTACTGGACCTACCCGGGCTCTCTG
                  ************************************************************

HsCD00041026      ACGACTCCCCCACTCAGTGAGAGTGTCACCTGGATTGTGCTCCGGGAGCCCATCTGCATC
NM_005182.2       ACGACTCCCCCACTCAGTGAGAGTGTCACCTGGATTGTGCTCCGGGAGCCCATCTGCATC
                  ************************************************************

HsCD00041026      TCTGAAAGGCAGATGGGGAAGTTCCGGAGCCTGCTTTTTACCTCGGAGGACGATGAGAGG
NM_005182.2       TCTGAAAGGCAGATGGGGAAGTTCCGGAGCCTGCTTTTTACCTCGGAGGACGATGAGAGG
                  ************************************************************

HsCD00041026      ATCCACATGGTGAACAACTTCCGGCCACCACAGCCACTGAAGGGCCGCGTGGTAAAGGCC
NM_005182.2       ATCCACATGGTGAACAACTTCCGGCCACCACAGCCACTGAAGGGCCGCGTGGTAAAGGCC
                  ************************************************************

HsCD00041026      TCCTTCCGGGCCTTG
NM_005182.2       TCCTTCCGGGCCTGA
                  ************* .

Pathways

Reactome : Metabolism
Reactome : Reversible hydration of carbon dioxide

Protein

SMART domain : Carb_anhydrase : Eukaryotic-type carbonic anhydrase
UniProt : P43166
UniProt : Q86YU0
HPRD : 00263

Clone

Cloning Information : 182880
HIP Master Clone ID : 157824
Original Clone ID : FLH182880.01L

Organism


TAX_ID : 9606
Species Specific ID: 766

Genome

Chromosome : 16
Map Location : 16q22.1
Ensembl : ENSG00000168748

Reagents

Labome : CA7-antibody