DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCPD_nGST-SBP_DC

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pCPD_nGST-SBP_DC              
Source: CPD
Description: Bacterial expression vector with a T7 promoter, N-terminal GST, Thrombin prtease cleavage site, SBP tag, and TEV protease cleavage site; ampicillin and chloamphenicol resistance in bacteria (CmR removed in clones with inserts); Gateway recombinational cloning.
Comments: None
Publications: None
Authors: Joshua LaBaer
Center for Personalized Diagnostics
Ji Qiu
Justin Saul
EvNO00412303

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DB3.1 T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pCPD_nGST-SBP_DC

pCPD_nGST-SBP_DC in advanced viewed

Synonyms: pCPD9-GST, pCPD_GST
Sequencing Primer: Forward:  pCPD5698_F
Reverse:  pCPD6268_R
Description: Bacterial expression vector with a T7 promoter, N-terminal GST, Thrombin prtease cleavage site, SBP tag, and TEV protease cleavage site; ampicillin and chloamphenicol resistance in bacteria (CmR removed in clones with inserts); Gateway recombinational cloning.
Comments: One in a series of pCPD vectors made by J. Saul for E. coli protein expression at CPD.
Size (bp): 7710
Parent Vector: None
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Center for Personalized Diagnostics
Ji Qiu
Justin Saul
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 replication origin 1344 2026
death cassette ccdB death cassette (removed when insert is present) 5864 7518
death cassette 2 ccdB (BsrGI removed) ccdB death cassette with BsrGI restriction enzyme cleavage site removed (death cassette removed when insert is present) 7073 7378
primer pCPD5698_F forward sequencing primer aattcatggacgagaagacc 5693 5712
primer pCPD6268_R reverse sequencing primer agccaactcagcttccttt 7598 7616
promoter T7 T7 promoter 4911 4927
protease cleavage site TEV TEV protease cleavage site 5818 5838
protease cleavage site Thrombin thrombin cleavage site 5674 5691
repressor protein gene LacI LacI repressor 3438 4397
ribosome binding site RBS pET ribosome binding site 4984 4990
selectable marker CmR chloramphenicol resistance (removed when insert is present) 6072 6728
selectable marker AmpR ampicillin resistance gene 587 1246
tag GST GST tag 4999 5667
tag SBP Streptavidin Binding Peptide tag 5698 5811
trxn regulatory element lac operator lac operator sequence 4930 4952
trxn termination sequence T7 term T7 terminator 7368 7685

 

Species Specific ID: None
Target GenBank: None