DNASU Plasmid Repository • 480.965.5697 | Email

SPHK1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SPHK1
Gene Name:  sphingosine kinase 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000041.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00004128

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1155nts         Open reading frame : 1 to 1155
Reference Sequence Alignment

ATGGATCCAGCGGGCGGCCCCCGGGGCGTGCTCCCGCGGCCCTGCCGCGTGCTGGTGCTG
CTGAACCCGCGCGGCGGCAAGGGCAAGGCCTTGCAGCTCTTCCGGAGTCACGTGCAGCCC
CTTTTGGCTGAGGCTGAAATCTCCTTCACGCTGATGCTCACTGAGCGGCGGAACCACGCG
CGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGACGCTCTGGTGGTCATGTCTGGA
GACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGGCCTGACTGGGAGACCGCC
ATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAACGCGCTGGCAGCTTCCTTG
AACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTCCTGACCAACTGCACGCTA
TTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCTCTGCACACGGCTTCGGGG
CTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATTGCTGATGTGGACCTAGAG
AGTGAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTGGGCACCTTCCTGCTTCTG
GCAGCCCTGCGCACCTACCGCGGCCGACTGGCCTACCTCCCTGTAGGAAGAGTGGGTTCC
AAGACACCTGCCTCCCCCGTTGTGGTCCAGCAGGGCCCGGTAGATGCACACCTTGTGCCA
CTGGAGGAGCCAGTGCCCTCTCACTGGACAGTGGTGCCCGACGAGGACTTTGTGCTAGTC
CTGGCACTGCTGCACTCGCACCTGGGCAGTGAGATGTTTGCTGCACCCATGGGCCGCTGT
GCAGCTGGCGTCATGCATCTGTTCTACGTGCGGGCGGGAGTGTCTCGTGCCATGCTGCTG
CGCCTCTTCCTGGCCATGGAGAAGGGCAGGCATATGGAGTATGAATGCCCCTACTTGGTA
TACGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGGAAAGGTGTGTTTGCAGTG
GATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTGCACCCAAACTACTTCTGG
ATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCCCAGCAGATGCCACCGCCA
GAAGAGCCCTTATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1493
Start on reference sequence 339
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SPHK1
Symbol Nomenclature : SPHK1
SYNONYM : SPHK
Designation : SK 1|SPK 1
Full Nomenclature : sphingosine kinase 1
GENEID : 8877
GI : 33303762
GenBank Accession : AY335568
HGNC : 11240
MIM : 603730
Vega : OTTHUMG00000180177
Target GenBank: BC008040

 

Reference Sequence Alignment

  

HsCD00004128        ------------------------------------------------------------
NM_001142602.1      ------------------------------------------------------------
NM_021972.3         ------------------------------------------------------------
NM_182965.2         ATGTCCGCTCAAGTTCTGGGATTTTTACGCAGCTGGACTCCCCTCCCCCTGGCAGCCCCG
NM_001142601.1      ------------------------------------------------------------
XM_005257766.1      ------------------------------------------------------------
                                                                                

HsCD00004128        ------------------------------------------------------------
NM_001142602.1      ------------------------------------------------------------
NM_021972.3         ------------------------------------------------------------
NM_182965.2         AGGGGTCCAGCCGCCGCAGGGAATGACGCCGGTGCTCCTGCAGCCACGGCTCCGGGCGGG
NM_001142601.1      ------------------------------------------------------------
XM_005257766.1      ------------------------------------------------------------
                                                                                

HsCD00004128        ------------------------------------------------------------
NM_001142602.1      ------------------------------------------------------------
NM_021972.3         ------------------------------------------------------------
NM_182965.2         GAAGGCGAGCCCCACAGCCGGCCCTGCGACGCCCGCCTGGGCAGCACCGATAAGGAGCTG
NM_001142601.1      ------------------------------------------------------------
XM_005257766.1      ------------------------------------------------------------
                                                                                

HsCD00004128        ------------------------------------------------------------
NM_001142602.1      ------------------------------------------------------------
NM_021972.3         ------------------------------------ATGGATCCAGTGGTCGGTTGCGGA
NM_182965.2         AAGGCAGGAGCCGCCGCCACGGGCAGCGCCCCCACAGCGCCAGGGACCCCCTGGCAGCGG
NM_001142601.1      ------------------------------------------------------------
XM_005257766.1      ------------------------------------------------------------
                                                                                

HsCD00004128        ------------------ATGGATCCAGCGGGCGGCCCCCGGGGCGTGCTCCCGCGGCCC
NM_001142602.1      ------------------ATGGATCCAGCGGGCGGCCCCCGGGGCGTGCTCCCGCGGCCC
NM_021972.3         CGTGGCCTCTTTGGTTTTGTTTTCTCAGCGGGCGGCCCCCGGGGCGTGCTCCCGCGGCCC
NM_182965.2         GAGCCGCGGGTCGAGGTTATGGATCCAGCGGGCGGCCCCCGGGGCGTGCTCCCGCGGCCC
NM_001142601.1      ------------------ATGGATCCAGCGGGCGGCCCCCGGGGCGTGCTCCCGCGGCCC
XM_005257766.1      ------------------ATGGATCCAGCGGGCGGCCCCCGGGGCGTGCTCCCGCGGCCC
                                      .*  :  ***********************************

HsCD00004128        TGCCGCGTGCTGGTGCTGCTGAACCCGCGCGGCGGCAAGGGCAAGGCCTTGCAGCTCTTC
NM_001142602.1      TGCCGCGTGCTGGTGCTGCTGAACCCGCGCGGCGGCAAGGGCAAGGCCTTGCAGCTCTTC
NM_021972.3         TGCCGCGTGCTGGTGCTGCTGAACCCGCGCGGCGGCAAGGGCAAGGCCTTGCAGCTCTTC
NM_182965.2         TGCCGCGTGCTGGTGCTGCTGAACCCGCGCGGCGGCAAGGGCAAGGCCTTGCAGCTCTTC
NM_001142601.1      TGCCGCGTGCTGGTGCTGCTGAACCCGCGCGGCGGCAAGGGCAAGGCCTTGCAGCTCTTC
XM_005257766.1      TGCCGCGTGCTGGTGCTGCTGAACCCGCGCGGCGGCAAGGGCAAGGCCTTGCAGCTCTTC
                    ************************************************************

HsCD00004128        CGGAGTCACGTGCAGCCCCTTTTGGCTGAGGCTGAAATCTCCTTCACGCTGATGCTCACT
NM_001142602.1      CGGAGTCACGTGCAGCCCCTTTTGGCTGAGGCTGAAATCTCCTTCACGCTGATGCTCACT
NM_021972.3         CGGAGTCACGTGCAGCCCCTTTTGGCTGAGGCTGAAATCTCCTTCACGCTGATGCTCACT
NM_182965.2         CGGAGTCACGTGCAGCCCCTTTTGGCTGAGGCTGAAATCTCCTTCACGCTGATGCTCACT
NM_001142601.1      CGGAGTCACGTGCAGCCCCTTTTGGCTGAGGCTGAAATCTCCTTCACGCTGATGCTCACT
XM_005257766.1      CGGAGTCACGTGCAGCCCCTTTTGGCTGAGGCTGAAATCTCCTTCACGCTGATGCTCACT
                    ************************************************************

HsCD00004128        GAGCGGCGGAACCACGCGCGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGACGCT
NM_001142602.1      GAGCGGCGGAACCACGCGCGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGACGCT
NM_021972.3         GAGCGGCGGAACCACGCGCGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGACGCT
NM_182965.2         GAGCGGCGGAACCACGCGCGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGACGCT
NM_001142601.1      GAGCGGCGGAACCACGCGCGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGACGCT
XM_005257766.1      GAGCGGCGGAACCACGCGCGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGACGCT
                    ************************************************************

HsCD00004128        CTGGTGGTCATGTCTGGAGACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGG
NM_001142602.1      CTGGTGGTCATGTCTGGAGACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGG
NM_021972.3         CTGGTGGTCATGTCTGGAGACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGG
NM_182965.2         CTGGTGGTCATGTCTGGAGACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGG
NM_001142601.1      CTGGTGGTCATGTCTGGAGACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGG
XM_005257766.1      CTGGTGGTCATGTCTGGAGACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGG
                    ************************************************************

HsCD00004128        CCTGACTGGGAGACCGCCATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAAC
NM_001142602.1      CCTGACTGGGAGACCGCCATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAAC
NM_021972.3         CCTGACTGGGAGACCGCCATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAAC
NM_182965.2         CCTGACTGGGAGACCGCCATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAAC
NM_001142601.1      CCTGACTGGGAGACCGCCATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAAC
XM_005257766.1      CCTGACTGGGAGACCGCCATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAAC
                    ************************************************************

HsCD00004128        GCGCTGGCAGCTTCCTTGAACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTC
NM_001142602.1      GCGCTGGCAGCTTCCTTGAACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTC
NM_021972.3         GCGCTGGCAGCTTCCTTGAACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTC
NM_182965.2         GCGCTGGCAGCTTCCTTGAACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTC
NM_001142601.1      GCGCTGGCAGCTTCCTTGAACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTC
XM_005257766.1      GCGCTGGCAGCTTCCTTGAACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTC
                    ************************************************************

HsCD00004128        CTGACCAACTGCACGCTATTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCT
NM_001142602.1      CTGACCAACTGCACGCTATTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCT
NM_021972.3         CTGACCAACTGCACGCTATTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCT
NM_182965.2         CTGACCAACTGCACGCTATTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCT
NM_001142601.1      CTGACCAACTGCACGCTATTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCT
XM_005257766.1      CTGACCAACTGCACGCTATTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCT
                    ************************************************************

HsCD00004128        CTGCACACGGCTTCGGGGCTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATT
NM_001142602.1      CTGCACACGGCTTCGGGGCTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATT
NM_021972.3         CTGCACACGGCTTCGGGGCTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATT
NM_182965.2         CTGCACACGGCTTCGGGGCTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATT
NM_001142601.1      CTGCACACGGCTTCGGGGCTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATT
XM_005257766.1      CTGCACACGGCTTCGGGGCTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATT
                    ************************************************************

HsCD00004128        GCTGATGTGGACCTAGAGAGTGAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTG
NM_001142602.1      GCTGATGTGGACCTAGAGAGTGAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTG
NM_021972.3         GCTGATGTGGACCTAGAGAGTGAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTG
NM_182965.2         GCTGATGTGGACCTAGAGAGTGAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTG
NM_001142601.1      GCTGATGTGGACCTAGAGAGTGAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTG
XM_005257766.1      GCTGATGTGGACCTAGAGAGTGAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTG
                    ************************************************************

HsCD00004128        GGCACCTTCCTGCTTCTGGCAGCCCTGCGCACCTACCGCGGCCGACTGGCCTACCTCCCT
NM_001142602.1      GGCACCTTCCTGCGTCTGGCAGCCCTGCGCACCTACCGCGGCCGACTGGCCTACCTCCCT
NM_021972.3         GGCACCTTCCTGCGTCTGGCAGCCCTGCGCACCTACCGCGGCCGACTGGCCTACCTCCCT
NM_182965.2         GGCACCTTCCTGCGTCTGGCAGCCCTGCGCACCTACCGCGGCCGACTGGCCTACCTCCCT
NM_001142601.1      GGCACCTTCCTGCGTCTGGCAGCCCTGCGCACCTACCGCGGCCGACTGGCCTACCTCCCT
XM_005257766.1      GGCACCTTCCTGCGTCTGGCAGCCCTGCGCACCTACCGCGGCCGACTGGCCTACCTCCCT
                    ************* **********************************************

HsCD00004128        GTAGGAAGAGTGGGTTCCAAGACACCTGCCTCCCCCGTTGTGGTCCAGCAGGGCCCGGTA
NM_001142602.1      GTAGGAAGAGTGGGTTCCAAGACACCTGCCTCCCCCGTTGTGGTCCAGCAGGGCCCGGTA
NM_021972.3         GTAGGAAGAGTGGGTTCCAAGACACCTGCCTCCCCCGTTGTGGTCCAGCAGGGCCCGGTA
NM_182965.2         GTAGGAAGAGTGGGTTCCAAGACACCTGCCTCCCCCGTTGTGGTCCAGCAGGGCCCGGTA
NM_001142601.1      GTAGGAAGAGTGGGTTCCAAGACACCTGCCTCCCCCGTTGTGGTCCAGCAGGGCCCGGTA
XM_005257766.1      GTAGGAAGAGTGGGTTCCAAGACACCTGCCTCCCCCGTTGTGGTCCAGCAGGGCCCGGTA
                    ************************************************************

HsCD00004128        GATGCACACCTTGTGCCACTGGAGGAGCCAGTGCCCTCTCACTGGACAGTGGTGCCCGAC
NM_001142602.1      GATGCACACCTTGTGCCACTGGAGGAGCCAGTGCCCTCTCACTGGACAGTGGTGCCCGAC
NM_021972.3         GATGCACACCTTGTGCCACTGGAGGAGCCAGTGCCCTCTCACTGGACAGTGGTGCCCGAC
NM_182965.2         GATGCACACCTTGTGCCACTGGAGGAGCCAGTGCCCTCTCACTGGACAGTGGTGCCCGAC
NM_001142601.1      GATGCACACCTTGTGCCACTGGAGGAGCCAGTGCCCTCTCACTGGACAGTGGTGCCCGAC
XM_005257766.1      GATGCACACCTTGTGCCACTGGAGGAGCCAGTGCCCTCTCACTGGACAGTGGTGCCCGAC
                    ************************************************************

HsCD00004128        GAGGACTTTGTGCTAGTCCTGGCACTGCTGCACTCGCACCTGGGCAGTGAGATGTTTGCT
NM_001142602.1      GAGGACTTTGTGCTAGTCCTGGCACTGCTGCACTCGCACCTGGGCAGTGAGATGTTTGCT
NM_021972.3         GAGGACTTTGTGCTAGTCCTGGCACTGCTGCACTCGCACCTGGGCAGTGAGATGTTTGCT
NM_182965.2         GAGGACTTTGTGCTAGTCCTGGCACTGCTGCACTCGCACCTGGGCAGTGAGATGTTTGCT
NM_001142601.1      GAGGACTTTGTGCTAGTCCTGGCACTGCTGCACTCGCACCTGGGCAGTGAGATGTTTGCT
XM_005257766.1      GAGGACTTTGTGCTAGTCCTGGCACTGCTGCACTCGCACCTGGGCAGTGAGATGTTTGCT
                    ************************************************************

HsCD00004128        GCACCCATGGGCCGCTGTGCAGCTGGCGTCATGCATCTGTTCTACGTGCGGGCGGGAGTG
NM_001142602.1      GCACCCATGGGCCGCTGTGCAGCTGGCGTCATGCATCTGTTCTACGTGCGGGCGGGAGTG
NM_021972.3         GCACCCATGGGCCGCTGTGCAGCTGGCGTCATGCATCTGTTCTACGTGCGGGCGGGAGTG
NM_182965.2         GCACCCATGGGCCGCTGTGCAGCTGGCGTCATGCATCTGTTCTACGTGCGGGCGGGAGTG
NM_001142601.1      GCACCCATGGGCCGCTGTGCAGCTGGCGTCATGCATCTGTTCTACGTGCGGGCGGGAGTG
XM_005257766.1      GCACCCATGGGCCGCTGTGCAGCTGGCGTCATGCATCTGTTCTACGTGCGGGCGGGAGTG
                    ************************************************************

HsCD00004128        TCTCGTGCCATGCTGCTGCGCCTCTTCCTGGCCATGGAGAAGGGCAGGCATATGGAGTAT
NM_001142602.1      TCTCGTGCCATGCTGCTGCGCCTCTTCCTGGCCATGGAGAAGGGCAGGCATATGGAGTAT
NM_021972.3         TCTCGTGCCATGCTGCTGCGCCTCTTCCTGGCCATGGAGAAGGGCAGGCATATGGAGTAT
NM_182965.2         TCTCGTGCCATGCTGCTGCGCCTCTTCCTGGCCATGGAGAAGGGCAGGCATATGGAGTAT
NM_001142601.1      TCTCGTGCCATGCTGCTGCGCCTCTTCCTGGCCATGGAGAAGGGCAGGCATATGGAGTAT
XM_005257766.1      TCTCGTGCCATGCTGCTGCGCCTCTTCCTGGCCATGGAGAAGGGCAGGCATATGGAGTAT
                    ************************************************************

HsCD00004128        GAATGCCCCTACTTGGTATACGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGG
NM_001142602.1      GAATGCCCCTACTTGGTATATGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGG
NM_021972.3         GAATGCCCCTACTTGGTATATGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGG
NM_182965.2         GAATGCCCCTACTTGGTATATGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGG
NM_001142601.1      GAATGCCCCTACTTGGTATATGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGG
XM_005257766.1      GAATGCCCCTACTTGGTATATGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGG
                    ******************** ***************************************

HsCD00004128        AAAGGTGTGTTTGCAGTGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTG
NM_001142602.1      AAAGGTGTGTTTGCAGTGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTG
NM_021972.3         AAAGGTGTGTTTGCAGTGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTG
NM_182965.2         AAAGGTGTGTTTGCAGTGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTG
NM_001142601.1      AAAGGTGTGTTTGCAGTGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTG
XM_005257766.1      AAAGGTGTGTTTGCAGTGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTG
                    ************************************************************

HsCD00004128        CACCCAAACTACTTCTGGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCC
NM_001142602.1      CACCCAAACTACTTCTGGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCC
NM_021972.3         CACCCAAACTACTTCTGGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCC
NM_182965.2         CACCCAAACTACTTCTGGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCC
NM_001142601.1      CACCCAAACTACTTCTGGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCC
XM_005257766.1      CACCCAAACTACTTCTGGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCC
                    ************************************************************

HsCD00004128        CAGCAGATGCCACCGCCAGAAGAGCCCTTATTG
NM_001142602.1      CAGCAGATGCCACCGCCAGAAGAGCCCTTATGA
NM_021972.3         CAGCAGATGCCACCGCCAGAAGAGCCCTTATGA
NM_182965.2         CAGCAGATGCCACCGCCAGAAGAGCCCTTATGA
NM_001142601.1      CAGCAGATGCCACCGCCAGAAGAGCCCTTATGA
XM_005257766.1      CAGCAGATGCCACCGCCAGAAGAGCCCTTATGA
                    ******************************* .

Pathways

NCI : Beta3 integrin cell surface interactions
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : PDGFR-beta signaling pathway
NCI : S1P1 pathway
NCI : Sphingosine 1-phosphate (S1P) pathway
Panther : Angiogenesis
Panther : VEGF signaling pathway
Reactome : Association of TriC/CCT with target proteins during biosynthesis
Reactome : Chaperonin-mediated protein folding
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Metabolism of proteins
Reactome : Protein folding
Reactome : Sphingolipid de novo biosynthesis
Reactome : Sphingolipid metabolism
WikiPathway : Signal Transduction of S1P Receptor

Protein

SMART domain : DAGKc : Diacylglycerol kinase catalytic domain (presumed)
UniProt : Q96GK1
UniProt : Q53ZR5
UniProt : Q9NYA1
HPRD : 04768

Clone

Cloning Information : 41
HIP Master Clone ID : 87414
Original Clone ID : FLH000041.01L

Organism


TAX_ID : 9606
Species Specific ID: 8877

Genome

Chromosome : 17
Map Location : 17q25.2
Ensembl : ENSG00000176170

Reagents

Labome : SPHK1-antibody