DNASU Plasmid Repository • 480.965.5697 | Email

B4GALNT3 (H. sapiens ) in pGEn2-DEST

TOP

Explanation of Terms


Gene: Gene Symbol:  B4GALNT3
Gene Name:  beta-1,4-N-acetyl-galactosaminyl transferase 3
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pGEn2-DEST               Format:  CLOSED
Source: Glyco-enzyme clone collection
Description: All clones in the PSI Materials Repository related to human and bacterial glycosylation enzymes (Glyco-enzyme clone collection) were generated through the support of NIH grant RR005351. All users of these clones are requested to cite this grant source on all publications employing these resources
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
Arizona State University
Kelley Moremen
University of Georgia
HsCD00413201

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 2835nts         Open reading frame : 1 to 2835
Reference Sequence Alignment

AACCGGAGGTACGGCAGCTGGAGAGAACTGGCCAAGGCTCTGGCCAGCAGGAACATTCCA
GCTGTGGATCCACACCTCCAGTTCTACCATCCCCAGAGGCTGAGCCTCGAGGACCACGAC
ATTGACCAAGGGGTGAGCAGTAACAGCAGCTACTTGAAGTGGAACAAGCCTGTCCCCTGG
CTCTCAGAGTTCCGGGGCCGTGCCAACCTGCATGTGTTTGAAGACTGGTGTGGCAGCTCT
ATCCAGCAGCTCAGGAGGAACCTGCATTTCCCACTGTACCCCCATATTCGCACAACCCTG
AGGAAGCTTGCTGTGTCCCCCAAATGGACCAACTATGGCCTCCGCATCTTTGGCTACCTG
CACCCCTTTACTGATGGGAAAATCCAGTTTGCCATTGCTGCAGATGACAACGCGGAGTTC
TGGCTGAGCCTCGATGACCAGGTCTCAGGCCTCCAGCTGCTGGCCAGTGTGGGCAAGACT
GGAAAGGAGTGGACCGCCCCGGGAGAGTTTGGGAAATTTCGGAGCCAAATTTCCAAGCCG
GTGAGCCTGTCAGCCTCCCACAGGTACTACTTCGAGGTGCTGCACAAGCAGAATGAGGAG
GGCACCGACCACGTGGAAGTTGCATGGCGACGGAACGACCCTGGAGCCAAGTTCACCATC
ATTGACTCCCTCTCCCTGTCCCTCTTCACAAATGAGACGTTCCTACAGATGGATGAGGTG
GGCCACATCCCACAGACAGCAGCCAGCCACGTGGACTCCTCCAACGCTCTTCCCAGGGAT
GAGCAGCCGCCCGCTGACATGCTTCGGCCTGACCCCCGGGACACCCTCTATCGAGTGCCT
CTGATCCCCAAGTCGCATCTCCGCCACGTCCTGCCTGACTGTCCCTACAAACCCAGCTAT
CTGGTGGATGGGCTTCCTCTGCAGCGCTACCAGGGACTCCGGTTTGTTCATCTGTCTTTT
GTTTACCCCAATGACTATACCCGCCTGAGCCACATGGAGACCCACAATAAATGTTTCTAC
CAGGAAAACGCCTACTACCAAGACCGGTTCAGCTTTCAGGAGTACATCAAGATTGACCAG
CCTGAGAAGCAGGGGCTGGAGCAGCCAGGTTTTGAGGAAAACCTTCTAGAAGAGTCCCAG
TATGGGGAAGTGGCAGAGGAGACCCCTGCCTCCAACAACCAGAATGCCAGGATGCTTGAG
GGAAGACAGACACCTGCCTCCACCCTGGAGCAAGATGCCACTGACTACCGCCTCCGAAGC
CTGCGGAAACTCCTGGCTCAGCCCCGGGAGGGCCTGCTGGCCCCCTTCTCCAAGCGGAAC
TCCACAGCGTCCTTCCCAGGGAGGACCAGCCACATTCCAGTGCAGCAGCCAGAGAAGAGG
AAGCAAAAACCCAGCCCTGAGCCCAGCCAAGATTCACCTCATTCCGACAAGTGGCCTCCT
GGGCACCCTGTGAAGAACCTGCCTCAGATGAGGGGGCCCAGGCCCAGGCCCGCTGGTGAC
AGCCCCAGGAAGACTCAGTGGCTGAACCAGGTGGAGTCGTACATCGCAGAGCAGAGACGG
GGTGACAGGATGCGGCCTCAGGCCCCTGGAAGGGGCTGGCATGGGGAGGAGGAAGTGGTG
GCGGCCGCAGGCCAGGAAGGACAAGTGGAGGGAGAGGAAGAGGGGGAAGAAGAGGAGGAG
GAAGAGGATATGAGTGAGGTGTTCGAGTACGTACCTGTGTTTGACCCGGTAGTAAACTGG
GACCAGACCTTCAGTGCCCGGAATCTCGACTTCCAAGCCCTGAGGACTGACTGGATCGAT
CTGAGCTGTAACACATCTGGCAACCTGCTGCTTCCAGAGCAGGAAGCTCTGGAGGTCACG
CGAGTCTTCTTGAAGAAGCTCAACCAGAGGAGCCGGGGGAGGTACCAGCTACAGCGCATT
GTGAACGTGGAAAAGCGTCAGGACCAGCTACGTGGGGGTCGCTACCTCCTGGAGCTTGAA
CTGTTGGAACAAGGCCAGCGCGTGGTGCGGCTCTCGGAGTATGTGTCTGCACGAGGCTGG
CAGGGCATCGATCCAGCTGGTGGGGAGGAGGTCGAGGCCCGGAACCTGCAAGGCCTGGTC
TGGGACCCACACAACCGTAGGAGACAGGTCCTGAATACCCGGGCCCAAGAGCCCAAGCTG
TGCTGGCCTCAGGGTTTCTCCTGGAGTCACCGAGCCGTGGTCCACTTCGTCGTGCCTGTG
AAGAACCAGGCACGCTGGGTACAGCAATTCATCAAAGACATGGAAAACCTGTTCCAGGTC
ACCGGTGACCCACACTTCAACATCGTCATCACTGACTATAGCAGTGAGGACATGGATGTT
GAGATGGCACTGAAGAGGTCCAAGCTGCGGAGCTACCAGTACGTGAAGCTAAGTGGAAAC
TTTGAACGCTCAGCTGGACTTCAGGCTGGCATAGACCTCGTGAAGGACCCGCACAGCATC
ATCTTCCTCTGTGACCTCCACATCCACTTCCCAGCTGGAGTCATCGATGCCATTCGGAAG
CACTGTGTGGAGGGAAAGATGGCCTTTGCCCCCATGGTGATGAGGCTGCATTGTGGGGCC
ACCCCCCAGTGGCCTGAGGGCTACTGGGAGGTGAATGGGTTCGGGCTGCTTGGCATCTAC
AAGTCTGACCTGGACAGGATTGGGGGCATGAACACCAAGGAGTTCCGAGACCGCTGGGGC
GGGGAAGACTGGGAGCTGCTGGACAGGATACTCCAAGCGGGCCTGGACGTGGAGCGTCTC
TCCCTCAGGAATTTCTTCCATCATTTCCATTCCAAGCGAGGCATGTGGAGCCGTCGCCAG
ATGAAGACGCTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pGEn2-DEST

pGEn2-DEST in advanced viewed

Synonyms: pXLG-NtermTCMhisAviGfp-DEST
Sequencing Primer: Forward:  pGEn2-DEST F
Reverse:  pGEn1-DEST R
Description: Mammalian expression vector with a CMV promoter and N-terminal 8xHis, AviTag, and Super GFP tags; ampicillin resistance in bacteria; Gateway recombinational cloning
Comments: None
Size (bp): 6930
Parent Vector: None
Empty Vector: EvNO00534624
Properties: Gateway, acceptor (destination), fluorescent marker, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: University of Georgia
Kelley Moremen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE Col E1 origin 1137 1804
death cassette ccdB ccdB death cassette (removed in plasmids with insert) 5072 5377
intron artificial intron artificial intron 2828 2960
poly-A signal BGH pA bovine growth hormone (BGH) polyadenylation signal 6106 6320
primer reverse reverse sequencing primer 5' TGACAACGGGCCACAACTCCTC 3' 5729 5750
primer forward forward sequencing primer 5? AGCATGCACCACCACCATCACC 3? 3049 3070
promoter CMV CMV promoter 2208 2790
recombination site 3'-ITR inverted terminal repeat sequence 6408 6537
recombination site attR2 attR2 recombinational cloning site 5418 5542
recombination site attR1 attR1 recombinational cloning site 3834 3962
recombination site 5'ITR inverted terminal repeat sequence 1998 2127
selectable marker CmR Chloramphenicol resistance (CmR) gene (removed in plasmids with insert) 4071 4720
selectable marker AmpR ampicillin resistance 129 1108
signal sequence TCM TCM signal sequence 2977 3052
tag AviTag AviTag 3079 3129
tag His N-terminal 8xHis tag 3055 3078
tag GFP N-terminal SuperGFP tag 3130 3825
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 5558 6099

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : B4GALNT3
Symbol Nomenclature : B4GALNT3
Designation : B4GalNAcT3|Beta4GalNAc-T3|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N- acetylgalactosaminyltransferase|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase 2|NGalNAc-T2|beta-1,4-N-acetylgalactosaminyltransferase 3|beta-1,4-N-acetylgalactosaminyltransferase III|beta4GalNAcT3
Full Nomenclature : beta-1,4-N-acetyl-galactosaminyl transferase 3
GENEID : 283358
GenBank Accession : BC156653
HGNC : 24137
MIM : 612220
Vega : OTTHUMG00000129283
Target GenBank: BC156653

 

Reference Sequence Alignment

  

HsCD00413201      ------------------------------------------------------------
NM_173593.3       ATGGGGAGCCCCCGGGCCGCGCGGCCCCCGCTGCTCCTGCGCCCGGTGAAGCTGCTGCGG
                                                                              

HsCD00413201      ------------------------------------------------------------
NM_173593.3       AGGCGCTTCCGGCTGCTGCTGGCGCTCGCCGTGGTGTCTGTGGGGCTCTGGACTCTGTAT
                                                                              

HsCD00413201      ------------------------------------------AACCGGAGGTACGGCAGC
NM_173593.3       CTGGAACTGGTGGCGTCGGCCCAGGTCGGCGGGAACCCCCTGAACCGGAGGTACGGCAGC
                                                            ******************

HsCD00413201      TGGAGAGAACTGGCCAAGGCTCTGGCCAGCAGGAACATTCCAGCTGTGGATCCACACCTC
NM_173593.3       TGGAGAGAACTGGCCAAGGCTCTGGCCAGCAGGAACATTCCAGCTGTGGATCCACACCTC
                  ************************************************************

HsCD00413201      CAGTTCTACCATCCCCAGAGGCTGAGCCTCGAGGACCACGACATTGACCAAGGGGTGAGC
NM_173593.3       CAGTTCTACCATCCCCAGAGGCTGAGCCTCGAGGACCACGACATTGACCAAGGGGTGAGC
                  ************************************************************

HsCD00413201      AGTAACAGCAGCTACTTGAAGTGGAACAAGCCTGTCCCCTGGCTCTCAGAGTTCCGGGGC
NM_173593.3       AGTAACAGCAGCTACTTGAAGTGGAACAAGCCTGTCCCCTGGCTCTCAGAGTTCCGGGGC
                  ************************************************************

HsCD00413201      CGTGCCAACCTGCATGTGTTTGAAGACTGGTGTGGCAGCTCTATCCAGCAGCTCAGGAGG
NM_173593.3       CGTGCCAACCTGCATGTGTTTGAAGACTGGTGTGGCAGCTCTATCCAGCAGCTCAGGAGG
                  ************************************************************

HsCD00413201      AACCTGCATTTCCCACTGTACCCCCATATTCGCACAACCCTGAGGAAGCTTGCTGTGTCC
NM_173593.3       AACCTGCATTTCCCACTGTACCCCCATATTCGCACAACCCTGAGGAAGCTTGCTGTGTCC
                  ************************************************************

HsCD00413201      CCCAAATGGACCAACTATGGCCTCCGCATCTTTGGCTACCTGCACCCCTTTACTGATGGG
NM_173593.3       CCCAAATGGACCAACTATGGCCTCCGCATCTTTGGCTACCTGCACCCCTTTACTGATGGG
                  ************************************************************

HsCD00413201      AAAATCCAGTTTGCCATTGCTGCAGATGACAACGCGGAGTTCTGGCTGAGCCTCGATGAC
NM_173593.3       AAAATCCAGTTTGCCATTGCTGCAGATGACAACGCGGAGTTCTGGCTGAGCCTCGATGAC
                  ************************************************************

HsCD00413201      CAGGTCTCAGGCCTCCAGCTGCTGGCCAGTGTGGGCAAGACTGGAAAGGAGTGGACCGCC
NM_173593.3       CAGGTCTCAGGCCTCCAGCTGCTGGCCAGTGTGGGCAAGACTGGAAAGGAGTGGACCGCC
                  ************************************************************

HsCD00413201      CCGGGAGAGTTTGGGAAATTTCGGAGCCAAATTTCCAAGCCGGTGAGCCTGTCAGCCTCC
NM_173593.3       CCGGGAGAGTTTGGGAAATTTCGGAGCCAAATTTCCAAGCCGGTGAGCCTGTCAGCCTCC
                  ************************************************************

HsCD00413201      CACAGGTACTACTTCGAGGTGCTGCACAAGCAGAATGAGGAGGGCACCGACCACGTGGAA
NM_173593.3       CACAGGTACTACTTCGAGGTGCTGCACAAGCAGAATGAGGAGGGCACCGACCACGTGGAA
                  ************************************************************

HsCD00413201      GTTGCATGGCGACGGAACGACCCTGGAGCCAAGTTCACCATCATTGACTCCCTCTCCCTG
NM_173593.3       GTTGCATGGCGACGGAACGACCCTGGAGCCAAGTTCACCATCATTGACTCCCTCTCCCTG
                  ************************************************************

HsCD00413201      TCCCTCTTCACAAATGAGACGTTCCTACAGATGGATGAGGTGGGCCACATCCCACAGACA
NM_173593.3       TCCCTCTTCACAAATGAGACGTTCCTACAGATGGATGAGGTGGGCCACATCCCACAGACA
                  ************************************************************

HsCD00413201      GCAGCCAGCCACGTGGACTCCTCCAACGCTCTTCCCAGGGATGAGCAGCCGCCCGCTGAC
NM_173593.3       GCAGCCAGCCACGTGGACTCCTCCAACGCTCTTCCCAGGGATGAGCAGCCGCCCGCTGAC
                  ************************************************************

HsCD00413201      ATGCTTCGGCCTGACCCCCGGGACACCCTCTATCGAGTGCCTCTGATCCCCAAGTCGCAT
NM_173593.3       ATGCTTCGGCCTGACCCCCGGGACACCCTCTATCGAGTGCCTCTGATCCCCAAGTCGCAT
                  ************************************************************

HsCD00413201      CTCCGCCACGTCCTGCCTGACTGTCCCTACAAACCCAGCTATCTGGTGGATGGGCTTCCT
NM_173593.3       CTCCGCCACGTCCTGCCTGACTGTCCCTACAAACCCAGCTATCTGGTGGATGGGCTTCCT
                  ************************************************************

HsCD00413201      CTGCAGCGCTACCAGGGACTCCGGTTTGTTCATCTGTCTTTTGTTTACCCCAATGACTAT
NM_173593.3       CTGCAGCGCTACCAGGGACTCCGGTTTGTTCATCTGTCTTTTGTTTACCCCAATGACTAT
                  ************************************************************

HsCD00413201      ACCCGCCTGAGCCACATGGAGACCCACAATAAATGTTTCTACCAGGAAAACGCCTACTAC
NM_173593.3       ACCCGCCTGAGCCACATGGAGACCCACAATAAATGTTTCTACCAGGAAAACGCCTACTAC
                  ************************************************************

HsCD00413201      CAAGACCGGTTCAGCTTTCAGGAGTACATCAAGATTGACCAGCCTGAGAAGCAGGGGCTG
NM_173593.3       CAAGACCGGTTCAGCTTTCAGGAGTACATCAAGATTGACCAGCCTGAGAAGCAGGGGCTG
                  ************************************************************

HsCD00413201      GAGCAGCCAGGTTTTGAGGAAAACCTTCTAGAAGAGTCCCAGTATGGGGAAGTGGCAGAG
NM_173593.3       GAGCAGCCAGGTTTTGAGGAAAACCTTCTAGAAGAGTCCCAGTATGGGGAAGTGGCAGAG
                  ************************************************************

HsCD00413201      GAGACCCCTGCCTCCAACAACCAGAATGCCAGGATGCTTGAGGGAAGACAGACACCTGCC
NM_173593.3       GAGACCCCTGCCTCCAACAACCAGAATGCCAGGATGCTTGAGGGAAGACAGACACCTGCC
                  ************************************************************

HsCD00413201      TCCACCCTGGAGCAAGATGCCACTGACTACCGCCTCCGAAGCCTGCGGAAACTCCTGGCT
NM_173593.3       TCCACCCTGGAGCAAGATGCCACTGACTACCGCCTCCGAAGCCTGCGGAAACTCCTGGCT
                  ************************************************************

HsCD00413201      CAGCCCCGGGAGGGCCTGCTGGCCCCCTTCTCCAAGCGGAACTCCACAGCGTCCTTCCCA
NM_173593.3       CAGCCCCGGGAGGGCCTGCTGGCCCCCTTCTCCAAGCGGAACTCCACAGCGTCCTTCCCA
                  ************************************************************

HsCD00413201      GGGAGGACCAGCCACATTCCAGTGCAGCAGCCAGAGAAGAGGAAGCAAAAACCCAGCCCT
NM_173593.3       GGGAGGACCAGCCACATTCCAGTGCAGCAGCCAGAGAAGAGGAAGCAAAAACCCAGCCCT
                  ************************************************************

HsCD00413201      GAGCCCAGCCAAGATTCACCTCATTCCGACAAGTGGCCTCCTGGGCACCCTGTGAAGAAC
NM_173593.3       GAGCCCAGCCAAGATTCACCTCATTCCGACAAGTGGCCTCCTGGGCACCCTGTGAAGAAC
                  ************************************************************

HsCD00413201      CTGCCTCAGATGAGGGGGCCCAGGCCCAGGCCCGCTGGTGACAGCCCCAGGAAGACTCAG
NM_173593.3       CTGCCTCAGATGAGGGGGCCCAGGCCCAGGCCCGCTGGTGACAGCCCCAGGAAGACTCAG
                  ************************************************************

HsCD00413201      TGGCTGAACCAGGTGGAGTCGTACATCGCAGAGCAGAGACGGGGTGACAGGATGCGGCCT
NM_173593.3       TGGCTGAACCAGGTGGAGTCGTACATCGCAGAGCAGAGACGGGGTGACAGGATGCGGCCT
                  ************************************************************

HsCD00413201      CAGGCCCCTGGAAGGGGCTGGCATGGGGAGGAGGAAGTGGTGGCGGCCGCAGGCCAGGAA
NM_173593.3       CAGGCCCCTGGAAGGGGCTGGCATGGGGAGGAGGAAGTGGTGGCGGCCGCAGGCCAGGAA
                  ************************************************************

HsCD00413201      GGACAAGTGGAGGGAGAGGAAGAGGGGGAAGAAGAGGAGGAGGAAGAGGATATGAGTGAG
NM_173593.3       GGACAAGTGGAGGGAGAGGAAGAGGGGGAAGAAGAGGAGGAGGAAGAGGATATGAGTGAG
                  ************************************************************

HsCD00413201      GTGTTCGAGTACGTACCTGTGTTTGACCCGGTAGTAAACTGGGACCAGACCTTCAGTGCC
NM_173593.3       GTGTTCGAGTACGTACCTGTGTTTGACCCGGTAGTAAACTGGGACCAGACCTTCAGTGCC
                  ************************************************************

HsCD00413201      CGGAATCTCGACTTCCAAGCCCTGAGGACTGACTGGATCGATCTGAGCTGTAACACATCT
NM_173593.3       CGGAATCTCGACTTCCAAGCCCTGAGGACTGACTGGATCGATCTGAGCTGTAACACATCT
                  ************************************************************

HsCD00413201      GGCAACCTGCTGCTTCCAGAGCAGGAAGCTCTGGAGGTCACGCGAGTCTTCTTGAAGAAG
NM_173593.3       GGCAACCTGCTGCTTCCAGAGCAGGAAGCTCTGGAGGTCACGCGAGTCTTCTTGAAGAAG
                  ************************************************************

HsCD00413201      CTCAACCAGAGGAGCCGGGGGAGGTACCAGCTACAGCGCATTGTGAACGTGGAAAAGCGT
NM_173593.3       CTCAACCAGAGGAGCCGGGGGAGGTACCAGCTACAGCGCATTGTGAACGTGGAAAAGCGT
                  ************************************************************

HsCD00413201      CAGGACCAGCTACGTGGGGGTCGCTACCTCCTGGAGCTTGAACTGTTGGAACAAGGCCAG
NM_173593.3       CAGGACCAGCTACGTGGGGGTCGCTACCTCCTGGAGCTTGAACTGTTGGAACAAGGCCAG
                  ************************************************************

HsCD00413201      CGCGTGGTGCGGCTCTCGGAGTATGTGTCTGCACGAGGCTGGCAGGGCATCGATCCAGCT
NM_173593.3       CGCGTGGTGCGGCTCTCGGAGTATGTGTCTGCACGAGGCTGGCAGGGCATCGATCCAGCT
                  ************************************************************

HsCD00413201      GGTGGGGAGGAGGTCGAGGCCCGGAACCTGCAAGGCCTGGTCTGGGACCCACACAACCGT
NM_173593.3       GGTGGGGAGGAGGTCGAGGCCCGGAACCTGCAAGGCCTGGTCTGGGACCCACACAACCGT
                  ************************************************************

HsCD00413201      AGGAGACAGGTCCTGAATACCCGGGCCCAAGAGCCCAAGCTGTGCTGGCCTCAGGGTTTC
NM_173593.3       AGGAGACAGGTCCTGAATACCCGGGCCCAAGAGCCCAAGCTGTGCTGGCCTCAGGGTTTC
                  ************************************************************

HsCD00413201      TCCTGGAGTCACCGAGCCGTGGTCCACTTCGTCGTGCCTGTGAAGAACCAGGCACGCTGG
NM_173593.3       TCCTGGAGTCACCGAGCCGTGGTCCACTTCGTCGTGCCTGTGAAGAACCAGGCACGCTGG
                  ************************************************************

HsCD00413201      GTACAGCAATTCATCAAAGACATGGAAAACCTGTTCCAGGTCACCGGTGACCCACACTTC
NM_173593.3       GTACAGCAATTCATCAAAGACATGGAAAACCTGTTCCAGGTCACCGGTGACCCACACTTC
                  ************************************************************

HsCD00413201      AACATCGTCATCACTGACTATAGCAGTGAGGACATGGATGTTGAGATGGCACTGAAGAGG
NM_173593.3       AACATCGTCATCACTGACTATAGCAGTGAGGACATGGATGTTGAGATGGCACTGAAGAGG
                  ************************************************************

HsCD00413201      TCCAAGCTGCGGAGCTACCAGTACGTGAAGCTAAGTGGAAACTTTGAACGCTCAGCTGGA
NM_173593.3       TCCAAGCTGCGGAGCTACCAGTACGTGAAGCTAAGTGGAAACTTTGAACGCTCAGCTGGA
                  ************************************************************

HsCD00413201      CTTCAGGCTGGCATAGACCTCGTGAAGGACCCGCACAGCATCATCTTCCTCTGTGACCTC
NM_173593.3       CTTCAGGCTGGCATAGACCTCGTGAAGGACCCGCACAGCATCATCTTCCTCTGTGACCTC
                  ************************************************************

HsCD00413201      CACATCCACTTCCCAGCTGGAGTCATCGATGCCATTCGGAAGCACTGTGTGGAGGGAAAG
NM_173593.3       CACATCCACTTCCCAGCTGGAGTCATCGATGCCATTCGGAAGCACTGTGTGGAGGGAAAG
                  ************************************************************

HsCD00413201      ATGGCCTTTGCCCCCATGGTGATGAGGCTGCATTGTGGGGCCACCCCCCAGTGGCCTGAG
NM_173593.3       ATGGCCTTTGCCCCCATGGTGATGAGGCTGCATTGTGGGGCCACCCCCCAGTGGCCTGAG
                  ************************************************************

HsCD00413201      GGCTACTGGGAGGTGAATGGGTTCGGGCTGCTTGGCATCTACAAGTCTGACCTGGACAGG
NM_173593.3       GGCTACTGGGAGGTGAATGGGTTCGGGCTGCTTGGCATCTACAAGTCTGACCTGGACAGG
                  ************************************************************

HsCD00413201      ATTGGGGGCATGAACACCAAGGAGTTCCGAGACCGCTGGGGCGGGGAAGACTGGGAGCTG
NM_173593.3       ATTGGGGGCATGAACACCAAGGAGTTCCGAGACCGCTGGGGCGGGGAAGACTGGGAGCTG
                  ************************************************************

HsCD00413201      CTGGACAGGATACTCCAAGCGGGCCTGGACGTGGAGCGTCTCTCCCTCAGGAATTTCTTC
NM_173593.3       CTGGACAGGATACTCCAAGCGGGCCTGGACGTGGAGCGTCTCTCCCTCAGGAATTTCTTC
                  ************************************************************

HsCD00413201      CATCATTTCCATTCCAAGCGAGGCATGTGGAGCCGTCGCCAGATGAAGACGCTGTAG
NM_173593.3       CATCATTTCCATTCCAAGCGAGGCATGTGGAGCCGTCGCCAGATGAAGACGCTGTAG
                  *********************************************************

Protein

SMART domain : PA14 :
UniProt : Q6L9W6
HPRD : 12514

Clone

Cloning Information : 581031

Organism


TAX_ID : 9606
Species Specific ID: 283358

Genome

Chromosome : 12
Map Location : 12p13.33
Ensembl : ENSG00000139044

Reagents

Labome : B4GALNT3-antibody