DNASU Plasmid Repository • 480.965.5697 | Email

AKR1C2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AKR1C2
Gene Name:  aldo-keto reductase family 1, member C2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH022886.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004148

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 972nts         Open reading frame : 1 to 972
Reference Sequence Alignment

ATGGATTCGAAATACCAGTGTGTGAAGCTGAATGATGGTCACTTCATGCCTGTCCTGGGA
TTTGGCACCTATGCGCCTGCAGAGGTTCCTAAAAGTAAAGCTCTAGAGGCCGTCAAATTG
GCAATAGAAGCCGGGTTCCACCATATTGATTCTGCACATGTTTACAATAATGAGGAGCAG
GTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTC
TACACTTCAAAGCTTTGGAGCAATTCCCATCGACCAGAGTTGGTCCGACCAGCCTTGGAA
AGGTCACTGAAAAATCTTCAATTGGACTATGTTGACCTCTATCTTATTCATTTTCCAGTG
TCTGTAAAGCCAGGTGAGGAAGTGATCCCAAAAGATGAAAATGGAAAAATACTATTTGAC
ACAGTGGATCTCTGTGCCACATGGGAGGCCATGGAGAAGTGTAAAGATGCAGGATTGGCC
AAGTCCATCGGGGTGTCCAACTTCAACCACAGGCTGCTGGAGATGATCCTCAACAAGCCA
GGGCTCAAGTACAAGCCTGTCTGCAACCAGGTGGAATGTCATCCTTACTTCAACCAGAGA
AAACTGCTGGATTTCTGCAAGTCAAAAGACATTGTTCTGGTTGCCTATAGTGCTCTGGGA
TCCCATCGAGAAGAACCATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTC
CTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAG
CTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
GTGCAGGTGTTTGAATTCCAGTTGACTTCAGAGGAGATGAAAGCCATAGATGGCCTAAAC
AGAAATGTGCGATATTTGACCCTTGATATTTTTGCTGGCCCCCCTAATTATCCATTTTCT
GATGAATATTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 994
Start on reference sequence 23
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AKR1C2
Symbol Nomenclature : AKR1C2
SYNONYM : AKR1C-pseudo; BABP; DD; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8; TDD
Designation : 3-alpha-HSD3|DD-2|DD/BABP|aldo-keto reductase family 1 member C2|chlordecone reductase homolog HAKRD|dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III|pseudo-chlordecone reductase|testicular 17,20-desmolase deficiency|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase|type II dihydrodiol dehydrogenase
Full Nomenclature : aldo-keto reductase family 1, member C2
GENEID : 1646
GI : 60653410
GenBank Accession : AY892483
HGNC : 385
MIM : 600450
Vega : OTTHUMG00000017584
Target GenBank: BC007024

 

Reference Sequence Alignment

  

HsCD00004148      ATGGATTCGAAATACCAGTGTGTGAAGCTGAATGATGGTCACTTCATGCCTGTCCTGGGA
NM_001354.5       ATGGATTCGAAATACCAGTGTGTGAAGCTGAATGATGGTCACTTCATGCCTGTCCTGGGA
NM_205845.2       ATGGATTCGAAATACCAGTGTGTGAAGCTGAATGATGGTCACTTCATGCCTGTCCTGGGA
NM_001353.5       ATGGATTCGAAATATCAGTGTGTGAAGCTGAATGATGGTCACTTCATGCCTGTCCTGGGA
                  ************** *********************************************

HsCD00004148      TTTGGCACCTATGCGCCTGCAGAGGTTCCTAAAAGTAAAGCTCTAGAGGCCGTCAAATTG
NM_001354.5       TTTGGCACCTATGCGCCTGCAGAGGTTCCTAAAAGTAAAGCTCTAGAGGCCGTCAAATTG
NM_205845.2       TTTGGCACCTATGCGCCTGCAGAGGTTCCTAAAAGTAAAGCTCTAGAGGCCGTCAAATTG
NM_001353.5       TTTGGCACCTATGCGCCTGCAGAGGTTCCTAAAAGTAAAGCTTTAGAGGCCACCAAATTG
                  ****************************************** ********. *******

HsCD00004148      GCAATAGAAGCCGGGTTCCACCATATTGATTCTGCACATGTTTACAATAATGAGGAGCAG
NM_001354.5       GCAATAGAAGCCGGGTTCCACCATATTGATTCTGCACATGTTTACAATAATGAGGAGCAG
NM_205845.2       GCAATAGAAGCCGGGTTCCACCATATTGATTCTGCACATGTTTACAATAATGAGGAGCAG
NM_001353.5       GCAATTGAAGCTGGCTTCCGCCATATTGATTCTGCTCATTTATACAATAATGAGGAGCAG
                  *****:***** ** ****.***************:*** *:******************

HsCD00004148      GTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTC
NM_001354.5       GTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTC
NM_205845.2       GTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTC
NM_001353.5       GTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTC
                  ************************************************************

HsCD00004148      TACACTTCAAAGCTTTGGAGCAATTCCCATCGACCAGAGTTGGTCCGACCAGCCTTGGAA
NM_001354.5       TACACTTCAAAGCTTTGGAGCAATTCCCATCGACCAGAGTTGGTCCGACCAGCCTTGGAA
NM_205845.2       TACACTTCAAAGCTTTGGAGCAATTCCCATCGACCAGAGTTGGTCCGACCAGCCTTGGAA
NM_001353.5       TACACTTCAAAGCTTTGGTGCAATTCCCATCGACCAGAGTTGGTCCGACCAGCCTTGGAA
                  ******************:*****************************************

HsCD00004148      AGGTCACTGAAAAATCTTCAATTGGACTATGTTGACCTCTATCTTATTCATTTTCCAGTG
NM_001354.5       AGGTCACTGAAAAATCTTCAATTGGACTATGTTGACCTCTATCTTATTCATTTTCCAGTG
NM_205845.2       AGGTCACTGAAAAATCTTCAATTGGACTATGTTGACCTCTATCTTATTCATTTTCCAGTG
NM_001353.5       AGGTCACTGAAAAATCTTCAATTGGATTATGTTGACCTCTACCTTATTCATTTTCCAGTG
                  ************************** ************** ******************

HsCD00004148      TCTGTAAAGCCAGGTGAGGAAGTGATCCCAAAAGATGAAAATGGAAAAATACTATTTGAC
NM_001354.5       TCTGTAAAGCCAGGTGAGGAAGTGATCCCAAAAGATGAAAATGGAAAAATACTATTTGAC
NM_205845.2       TCTGTAAAGCCAGGTGAGGAAGTGATCCCAAAAGATGAAAATGGAAAAATACTATTTGAC
NM_001353.5       TCTGTAAAGCCAGGTGAGGAAGTGATCCCAAAAGATGAAAATGGAAAAATACTATTTGAC
                  ************************************************************

HsCD00004148      ACAGTGGATCTCTGTGCCACATGGGAGGCCATGGAGAAGTGTAAAGATGCAGGATTGGCC
NM_001354.5       ACAGTGGATCTCTGTGCCACATGGGAGGCCATGGAGAAGTGTAAAGATGCAGGATTGGCC
NM_205845.2       ACAGTGGATCTCTGTGCCACATGGGAGGCCATGGAGAAGTGTAAAGATGCAGGATTGGCC
NM_001353.5       ACAGTGGATCTCTGTGCCACATGGGAGGCCGTGGAGAAGTGTAAAGATGCAGGATTGGCC
                  ******************************.*****************************

HsCD00004148      AAGTCCATCGGGGTGTCCAACTTCAACCACAGGCTGCTGGAGATGATCCTCAACAAGCCA
NM_001354.5       AAGTCCATCGGGGTGTCCAACTTCAACCACAGGCTGCTGGAGATGATCCTCAACAAGCCA
NM_205845.2       AAGTCCATCGGGGTGTCCAACTTCAACCACAGGCTGCTGGAGATGATCCTCAACAAGCCA
NM_001353.5       AAGTCCATCGGGGTGTCCAACTTCAACCGCAGGCAGCTGGAGATGATCCTCAACAAGCCA
                  ****************************.*****:*************************

HsCD00004148      GGGCTCAAGTACAAGCCTGTCTGCAACCAGGTGGAATGTCATCCTTACTTCAACCAGAGA
NM_001354.5       GGGCTCAAGTACAAGCCTGTCTGCAACCAGGTGGAATGTCATCCTTACTTCAACCAGAGA
NM_205845.2       GGGCTCAAGTACAAGCCTGTCTGCAACCAGGTGGAATGTCATCCTTACTTCAACCAGAGA
NM_001353.5       GGGCTCAAGTACAAGCCTGTCTGCAACCAGGTGGAATGTCATCCTTACTTCAACCAGAGA
                  ************************************************************

HsCD00004148      AAACTGCTGGATTTCTGCAAGTCAAAAGACATTGTTCTGGTTGCCTATAGTGCTCTGGGA
NM_001354.5       AAACTGCTGGATTTCTGCAAGTCAAAAGACATTGTTCTGGTTGCCTATAGTGCTCTGGGA
NM_205845.2       AAACTGCTGGATTTCTGCAAGTCAAAAGACATTGTTCTGGTTGCCTATAGTGCTCTGGGA
NM_001353.5       AAACTGCTGGATTTCTGCAAGTCAAAAGACATTGTTCTGGTTGCCTATAGTGCTCTGGGA
                  ************************************************************

HsCD00004148      TCCCATCGAGAAGAACCATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTC
NM_001354.5       TCCCATCGAGAAGAACCATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTC
NM_205845.2       TCCCATCGAGAAGAACCATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTC
NM_001353.5       TCCCACCGAGAAGAACCATGGGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTC
                  ***** ******************************************************

HsCD00004148      CTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAG
NM_001354.5       CTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAG
NM_205845.2       CTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAG
NM_001353.5       CTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAG
                  ************************************************************

HsCD00004148      CTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
NM_001354.5       CTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
NM_205845.2       CTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
NM_001353.5       CTACAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
                  **.*********************************************************

HsCD00004148      GTGCAGGTGTTTGAATTCCAGTTGACTTCAGAGGAGATGAAAGCCATAGATGGCCTAAAC
NM_001354.5       GTGCAGGTGTTTGAATTCCAGTTGACTTCAGAGGAGATGAAAGCCATAGATGGCCTAAAC
NM_205845.2       GTGCAGGTGTTTGAATTCCAGTTGACTTCAGAGGAGATGAAAGCCATAGATGGCCTAAAC
NM_001353.5       GTGCAGGTGTTTGAATTCCAGTTGACTTCAGAGGAGATGAAAGCCATAGATGGCCTAAAC
                  ************************************************************

HsCD00004148      AGAAATGTGCGATATTTGACCCTTGATATTTTTGCTGGCCCCCCTAATTATCCATTTTCT
NM_001354.5       AGAAATGTGCGATATTTGACCCTTGATATTTTTGCTGGCCCCCCTAATTATCCATTTTCT
NM_205845.2       AGAAATGTGCGATATTTGACCCTTGATATTTTTGCTGGCCCCCCTAATTATCCATTTTCT
NM_001353.5       AGAAATGTGCGATATTTGACCCTTGATATTTTTGCTGGCCCCCCTAATTATCCATTTTCT
                  ************************************************************

HsCD00004148      GATGAATATTTG
NM_001354.5       GATGAATATTAA
NM_205845.2       GATGAATATTAA
NM_001353.5       GATGAATATTAA
                  **********:.

Pathways

Reactome : Bile acid and bile salt metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Synthesis of bile acids and bile salts
Reactome : Synthesis of bile acids and bile salts via 24-hydroxycholesterol
Reactome : Synthesis of bile acids and bile salts via 27-hydroxycholesterol
Reactome : Synthesis of bile acids and bile salts via 7alpha-hydroxycholesterol
WikiPathway : Benzo(a)pyrene metabolism
WikiPathway : metapathway biotransformation

Protein

UniProt : B4DKR9
UniProt : P52895
HPRD : 11857

Clone

Cloning Information : 22886
HIP Master Clone ID : 53262
Original Clone ID : FLH022886.01L

Organism


TAX_ID : 9606
Species Specific ID: 1646

Genome

Chromosome : 10
Map Location : 10p15-p14
Ensembl : ENSG00000151632

Reagents

Labome : AKR1C2-antibody