DNASU Plasmid Repository • 480.965.5697 | Email

RPA2 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPA2
Gene Name:  replication protein A2, 32kDa
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH187971.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00041560

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 813nts         Open reading frame : 1 to 813
Reference Sequence Alignment

ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCCTCATACGGGGGAGCCGGCGGCTAC
ACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCTTCTCAAGCCGAAAAGAAATCAAGA
GCCCGAGCCCAGCACATTGTGCCCTGTACTATATCTCAGCTGCTTTCTGCCACTTTGGTT
GATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCACAGGTCACTATTGTGGGGATCATC
AGACATGCAGAGAAGGCTCCAACCAACATTGTTTACAAAATAGATGACATGACAGCTGCA
CCCATGGACGTTCGCCAGTGGGTTGACACAGATGACACCAGCAGTGAAAACACTGTGGTT
CCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTGAGATCTTTTCAGAACAAAAAGAGC
CTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATGAATGAGTTCACCACACATATTCTG
GAAGTGATCAATGCACACATGGTACTAAGCAAAGCCAACAGCCAGCCCTCAGCAGGGAGA
GCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGGAACTTTGGTGGGAATAGCTTCATG
CCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTGTTGAATTTGATTAAGGCTTGTCCA
AGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAACCAGCTGAAACACATGTCTGTATCC
TCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAGGGGCACATCTATTCTACTGTGGAT
GATGACCATTTTAAATCCACAGATGCAGAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 904
Start on reference sequence 92
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPA2
Symbol Nomenclature : RPA2
SYNONYM : REPA2; RPA32
Designation : RF-A protein 2|RP-A p32|RP-A p34|replication factor A protein 2|replication protein A 32 kDa subunit|replication protein A 34 kDa subunit
Full Nomenclature : replication protein A2, 32kDa
GENEID : 6118
Locus Tag : RP4-547C9.3
HGNC : 10290
MIM : 179836
Vega : OTTHUMG00000003915
Target GenBank: BC001630

 

Reference Sequence Alignment

  

HsCD00041560        ------------------------ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCC
XM_005245965.1      ATGGGCAGAGGAGACAGGAACAAGCGTAGCATCCGTGGATTCGAAAGCTATGGCAGCTCC
NM_002946.4         ------------------------ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCC
                                            .  :* *:*.**************************

HsCD00041560        TCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCT
XM_005245965.1      TCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCT
NM_002946.4         TCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCT
                    ************************************************************

HsCD00041560        TCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCT
XM_005245965.1      TCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCT
NM_002946.4         TCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCT
                    ************************************************************

HsCD00041560        CAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCA
XM_005245965.1      CAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCA
NM_002946.4         CAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCA
                    ************************************************************

HsCD00041560        CAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTAC
XM_005245965.1      CAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTAC
NM_002946.4         CAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTAC
                    ************************************************************

HsCD00041560        AAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGAC
XM_005245965.1      AAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGAC
NM_002946.4         AAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGAC
                    ************************************************************

HsCD00041560        ACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG
XM_005245965.1      ACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG
NM_002946.4         ACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG
                    ************************************************************

HsCD00041560        AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATG
XM_005245965.1      AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATG
NM_002946.4         AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATG
                    ************************************************************

HsCD00041560        AATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCC
XM_005245965.1      AATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCC
NM_002946.4         AATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCC
                    ************************************************************

HsCD00041560        AACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGG
XM_005245965.1      AACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGG
NM_002946.4         AACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGG
                    ************************************************************

HsCD00041560        AACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTG
XM_005245965.1      AACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTG
NM_002946.4         AACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTG
                    ************************************************************

HsCD00041560        TTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAAC
XM_005245965.1      TTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAAC
NM_002946.4         TTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAAC
                    ************************************************************

HsCD00041560        CAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAG
XM_005245965.1      CAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAG
NM_002946.4         CAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAG
                    ************************************************************

HsCD00041560        GGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATTG
XM_005245965.1      GGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATAA
NM_002946.4         GGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATAA
                    *******************************************************:.

Pathways

NCI : ATR signaling pathway
NCI : Fanconi anemia pathway
Panther : DNA replication
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : Double-Strand Break Repair
Reactome : Dual incision reaction in GG-NER
Reactome : Extension of Telomeres
Reactome : Formation of incision complex in GG-NER
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : HSF1 activation
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Lagging Strand Synthesis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Nucleotide Excision Repair
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
Reactome : Processing of DNA double-strand break ends
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : miRNA regulation of DNA Damage Response

Protein

UniProt : P15927
HPRD : 01566

Clone

Cloning Information : 187971
HIP Master Clone ID : 162915
Original Clone ID : FLH187971.01L

Organism


TAX_ID : 9606
Species Specific ID: 6118

Genome

Chromosome : 1
Map Location : 1p35
Ensembl : ENSG00000117748

Reagents

Labome : RPA2-antibody