DNASU Plasmid Repository • 480.965.2857 | Email

DRD3 (Homo sapiens) in pFASTBAC1 (Transfer vector to E. coli from expression bacmid)

TOP

Explanation of Terms


Gene: Gene Symbol:  DRD3
Gene Name:  dopamine receptor D3
Sequence             
Original Clone ID: GPCR-38
Keyword: full length
Species: Homo sapiens
Type: cDNA
Vector Name: pFASTBAC1               Format:  CLOSED
Source: GPCR Network
Description: None
Comments: None
Mutation/
Discrepancy :
Yes / No
Publications: PMID: 21097933
Title: Structure of the human dopamine D3 receptor in complex with a D2/D3 selective antagonist.
Authors: GPCR Network
PSI:Biology
HsCD00416047

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1530nts         Open reading frame : 1 to 1530

ATGAAGACGATCATCGCCCTGAGCTACATCTTCTGCCTGGTGTTCGCCGACTACAAGGAC
GATGATGACGGCGCGCCGGCGTCTTTGTCCCAGCTTTCTTCTCACTTGAATTACACTTGC
GGAGCTGAAAACAGCACGGGCGCTTCCCAGGCTAGGCCCCACGCCTACTACGCGCTGAGT
TACTGCGCGTTGATCCTCGCGATTGTGTTTGGTAACGGCCTGGTCTGCATGGCGGTCTTG
AAAGAACGCGCTTTGCAAACTACAACGAATTACCTTGTAGTGTCTCTGGCGGTCGCGGAC
CTCTTGGTCGCGACGTTGGTGATGCCTTGGGTTGTGTACCTGGAGGTAACGGGCGGAGTT
TGGAACTTCAGCAGGATCTGCTGCGACGTCTTCGTGACTCTCGATGTGATGATGTGCACC
GCGTCAATTTGGAACTTGTGCGCCATCTCCATCGACCGTTACACTGCGGTTGTCATGCCT
GTCCACTACCAACACGGTACCGGACAGTCTTCTTGCCGCCGTGTGGCGTTGATGATCACT
GCTGTCTGGGTGCTCGCCTTCGCTGTTAGTTGCCCCCTCCTTTTCGGTTTCAACACTACT
GGAGATCCTACCGTTTGCTCAATATCAAACCCGGACTTCGTTATCTACTCCTCTGTTGTG
TCGTTTTACCTCCCGTTTGGCGTCACCGTGCTTGTCTACGCGAGAATCTATGTGGTTCTG
AAACAGCGTAGGCGCAAGAATATCTTCGAGATGCTGCGTATCGACGAGGGTCTTCGTTTG
AAGATCTATAAGGACACCGAAGGATACTATACTATAGGCATCGGTCATTTGTTGACTAAG
TCTCCATCACTTAACGCCGCGAAGTCCGAACTGGACAAAGCCATTGGTAGAAACACAAAC
GGCGTGATTACCAAGGACGAGGCGGAGAAGCTCTTTAACCAAGACGTGGACGCGGCCGTT
CGTGGCATCTTGAGAAATGCAAAGCTCAAACCCGTGTACGACTCGCTTGACGCAGTTAGA
AGAGCTGCTCTGATCAACATGGTCTTCCAAATGGGAGAGACAGGTGTTGCAGGTTTTACC
AATAGCCTGCGTATGCTTCAACAAAAGAGGTGGGATGAAGCTGCTGTTAACCTGGCGAAA
AGCCGTTGGTACAACCAGACCCCAAACCGTGCCAAGAGAGTTATTACAACTTTTAGGACC
GGAACATGGGACGCTTACGGCGTGCCCCTTAGGGAGAAAAAGGCCACACAAATGGTGGCT
ATCGTACTTGGTGCTTTCATCGTCTGTTGGCTGCCGTTCTTCCTCACCCACGTTCTGAAT
ACCCACTGCCAAACCTGCCACGTCAGTCCGGAATTGTATTCTGCTACTACTTGGCTCGGC
TACGTCAATAGTGCTCTCAACCCTGTCATTTATACAACCTTCAATATCGAGTTTAGAAAG
GCTTTCCTCAAGATCCTTTCGTGTGGCCGGCCTCTGGAAGTTCTGTTCCAGGGGCCCCAT
CATCATCATCATCATCATCATCATCATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
L119W

Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  insect cells    Marker:  gentamicin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in GPCR-38
Recommended expression in: Sf9
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pFASTBAC1

pFASTBAC1 in advanced viewed

Synonyms: pFB-1, pFB1
Sequencing Primer: Forward:  pFB Forward
Reverse:  pFB Reverse
Description: Transfer vector (to E. coli from expression bacmid) with polyhedrin promoter, adds SV40 polyA site; amp resistance (gentamycin for selection in insect cells); restriction enzyme cloning.
Comments: requires transformation into E. coli DH10Bac for bacmid production
Size (bp): 4775
Parent Vector: None
Empty Vector: None
Properties: baculovirus/insect cell expression, multiple cloning site
Author Name: Midwest Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes BamHI, EcoRI, NotI, XhoI) 4037 4142
bacterial origin pUC ori pUC-type origin of replication 1594 2267
poly-A signal polyA SV40 polyA signal sequence 4205 4396
promoter PH polyhedrin promoter for insect cell expression 3904 4032
selectable marker GenR gentamycin resistance gene 3000 3533
selectable marker AmpR ampicillin resistance gene 787 1446
ssDNA origin f1 f1 origin of replication 2 19
transposon fragment Tn7L Tn7L transposon site 4429 4594
transposon fragment Tn7R Tn7R transposon site 2709 2933

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DRD3
Symbol Nomenclature : DRD3
SYNONYM : D3DR; ETM1; FET1
Designation : D(3) dopamine receptor|essential tremor 1
Full Nomenclature : dopamine receptor D3
GENEID : 1814
GI : 89191861
GenBank Accession : NM_000796
HGNC : 3024
MIM : 126451
Vega : OTTHUMG00000159334
Target GenBank: NM_000796.3

 

Pathways

Reactome : Amine ligand-binding receptors
Reactome : Class A/1 (Rhodopsin-like receptors)
Reactome : Dopamine receptors
Reactome : G alpha (i) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Signal Transduction
Reactome : Signaling by GPCR
WikiPathway : GPCRs, Class A Rhodopsin-like
WikiPathway : GPCRs, Other
WikiPathway : Monoamine GPCRs
WikiPathway : Nicotine Activity on Dopaminergic Neurons

Protein

PDB - Structural Annotation : 3PBL
Structural Annotation Wiki : TOPSAN
HPRD : 00540
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 579193
HIP Master Clone ID : 484792
Original Clone ID : GPCR-38

Experimental

Structural Biology Knowledgebase : SBKB (3PBL)
TargetTrack - Experimental data : GPCR-38

Organism


TAX_ID : 9606
Species Specific ID: 1814

Genome

Chromosome : 3
Map Location : 3q13.3
Ensembl : ENSG00000151577

Reagents

Labome : DRD3-antibody