DNASU Plasmid Repository • 480.965.5697 | Email

RPA3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPA3
Gene Name:  replication protein A3, 14kDa
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH025105.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00004169

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 366nts         Open reading frame : 1 to 366
Reference Sequence Alignment

ATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAACGCCGGCATGCTAGCTCAATTC
ATCGACAAGCCTGTCTGCTTCGTAGGGAGGCTGGAAAAGATTCATCCCACCGGAAAAATG
TTTATTCTTTCAGATGGAGAAGGAAAAAATGGAACCATCGAGTTGATGGAACCCCTTGAT
GAAGAAATCTCTGGAATTGTGGAAGTGGTTGGAAGAGTAACCGCCAAGGCCACCATCTTG
TGTACATCTTATGTCCAGTTTAAAGAAGATAGCCATCCTTTTGATCTTGGACTTTACAAT
GAAGCTGTGAAAATTATCCATGACTTCCCTCAGTTTTATCCTTTAGGGATTGTGCAACAT
GATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 411
Start on reference sequence 46
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPA3
Symbol Nomenclature : RPA3
SYNONYM : REPA3
Designation : RF-A protein 3|RP-A p14|replication factor A protein 3|replication protein A 14 kDa subunit
Full Nomenclature : replication protein A3, 14kDa
GENEID : 6119
GI : 60656466
GenBank Accession : AY890006
HGNC : 10291
MIM : 179837
Target GenBank: BC005264

 

Reference Sequence Alignment

  

HsCD00004169      ATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAACGCCGGCATGCTAGCTCAATTC
NM_002947.3       ATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAACGCCGGCATGCTAGCTCAATTC
                  ************************************************************

HsCD00004169      ATCGACAAGCCTGTCTGCTTCGTAGGGAGGCTGGAAAAGATTCATCCCACCGGAAAAATG
NM_002947.3       ATCGACAAGCCTGTCTGCTTCGTAGGGAGGCTGGAAAAGATTCATCCCACCGGAAAAATG
                  ************************************************************

HsCD00004169      TTTATTCTTTCAGATGGAGAAGGAAAAAATGGAACCATCGAGTTGATGGAACCCCTTGAT
NM_002947.3       TTTATTCTTTCAGATGGAGAAGGAAAAAATGGAACCATCGAGTTGATGGAACCCCTTGAT
                  ************************************************************

HsCD00004169      GAAGAAATCTCTGGAATTGTGGAAGTGGTTGGAAGAGTAACCGCCAAGGCCACCATCTTG
NM_002947.3       GAAGAAATCTCTGGAATTGTGGAAGTGGTTGGAAGAGTAACCGCCAAGGCCACCATCTTG
                  ************************************************************

HsCD00004169      TGTACATCTTATGTCCAGTTTAAAGAAGATAGCCATCCTTTTGATCTTGGACTTTACAAT
NM_002947.3       TGTACATCTTATGTCCAGTTTAAAGAAGATAGCCATCCTTTTGATCTTGGACTTTACAAT
                  ************************************************************

HsCD00004169      GAAGCTGTGAAAATTATCCATGACTTCCCTCAGTTTTATCCTTTAGGGATTGTGCAACAT
NM_002947.3       GAAGCTGTGAAAATTATCCATGACTTCCCTCAGTTTTATCCTTTAGGGATTGTGCAACAT
                  ************************************************************

HsCD00004169      GATTAG
NM_002947.3       GATTGA
                  ****..

Pathways

Panther : Cell cycle
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : Double-Strand Break Repair
Reactome : Dual incision reaction in GG-NER
Reactome : Extension of Telomeres
Reactome : Formation of incision complex in GG-NER
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : HSF1 activation
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Lagging Strand Synthesis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Nucleotide Excision Repair
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
Reactome : Processing of DNA double-strand break ends
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication
WikiPathway : G1 to S cell cycle control

Protein

UniProt : A4D105
UniProt : P35244
HPRD : 01567

Clone

Cloning Information : 25105
HIP Master Clone ID : 55481
Original Clone ID : FLH025105.01X

Organism


TAX_ID : 9606
Species Specific ID: 6119

Genome

Chromosome : 7
Map Location : 7p22

Reagents

Labome : RPA3-antibody