DNASU Plasmid Repository • 480.965.5697 | Email

OGG1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  OGG1
Gene Name:  8-oxoguanine DNA glycosylase
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH190365.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00041846

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1038nts         Open reading frame : 1 to 1038
Reference Sequence Alignment

ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGTGCTGTTCAGT
GCCGACCTGCGCCAATGCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCC
AAAGGGCCGGAAGGCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1344
Start on reference sequence 307
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : OGG1
Symbol Nomenclature : OGG1
SYNONYM : HMMH; HOGG1; MUTM; OGH1
Designation : 8-hydroxyguanine DNA glycosylase|AP lyase|DNA-apurinic or apyrimidinic site lyase|N-glycosylase/DNA lyase|OGG1 type 1f
Full Nomenclature : 8-oxoguanine DNA glycosylase
GENEID : 4968
HGNC : 8125
MIM : 601982
Vega : OTTHUMG00000097091
Target GenBank: BC000657

 

Reference Sequence Alignment

  

HsCD00041846      ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_002542.5       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016819.3       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016821.2       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016829.2       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016820.3       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
NM_016828.2       ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCT
                  ************************************************************

HsCD00041846      GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_002542.5       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016819.3       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016821.2       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016829.2       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016820.3       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
NM_016828.2       GCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCT
                  ************************************************************

HsCD00041846      TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_002542.5       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016819.3       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016821.2       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016829.2       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016820.3       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
NM_016828.2       TCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCG
                  ************************************************************

HsCD00041846      GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_002542.5       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016819.3       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016821.2       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016829.2       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016820.3       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
NM_016828.2       GATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGA
                  ************************************************************

HsCD00041846      GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_002542.5       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016819.3       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016821.2       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016829.2       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016820.3       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
NM_016828.2       GACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTC
                  ************************************************************

HsCD00041846      CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_002542.5       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016819.3       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016821.2       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016829.2       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016820.3       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
NM_016828.2       CAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTC
                  ************************************************************

HsCD00041846      CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_002542.5       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016819.3       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016821.2       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016829.2       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016820.3       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
NM_016828.2       CAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGC
                  ************************************************************

HsCD00041846      CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_002542.5       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016819.3       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016821.2       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016829.2       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016820.3       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
NM_016828.2       CTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAG
                  ************************************************************

HsCD00041846      CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_002542.5       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016819.3       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016821.2       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016829.2       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016820.3       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
NM_016828.2       CGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGC
                  ************************************************************

HsCD00041846      TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_002542.5       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016819.3       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016821.2       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016829.2       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016820.3       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
NM_016828.2       TTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGC
                  ************************************************************

HsCD00041846      CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_002542.5       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016819.3       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016821.2       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016829.2       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016820.3       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
NM_016828.2       CTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGC
                  ************************************************************

HsCD00041846      GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_002542.5       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016819.3       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016821.2       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016829.2       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016820.3       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
NM_016828.2       GGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTC
                  ************************************************************

HsCD00041846      TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_002542.5       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016819.3       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016821.2       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016829.2       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016820.3       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
NM_016828.2       TGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGAC
                  ************************************************************

HsCD00041846      AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_002542.5       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016819.3       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016821.2       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016829.2       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016820.3       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
NM_016828.2       AAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGC
                  ************************************************************

HsCD00041846      TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_002542.5       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016819.3       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016821.2       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016829.2       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016820.3       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
NM_016828.2       TGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGA
                  ************************************************************

HsCD00041846      AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGG-----------------CCC
NM_002542.5       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGG-----------------GCCC
NM_016819.3       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGG-----------
NM_016821.2       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGGCCTCCTTGGC
NM_016829.2       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGCTGGATCAGAT
NM_016820.3       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGACTCCACCCTCC
NM_016828.2       AACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGCTCTGTCAGGTC
                  ***************************************                     

HsCD00041846      AAGCGGTGCTGTTCAG--------------------------------------TGCCGA
NM_002542.5       AAGCGGTGCTGTTCAG--------------------------------------TGCCGA
NM_016819.3       ------------------------------------------------TGAGTGTACCTA
NM_016821.2       AATGCATTTGATGGCCACCAGCTTCTGCGTCCTCTTATCTTCTGCCAGGATCACCTCCGA
NM_016829.2       GCCTCCTGA---------------------------------------------------
NM_016820.3       TACAGGTGCTGTTCAG--------------------------------------TGCCGA
NM_016828.2       ATCACCACTTTTATG---------------------------------------ACCTTT
                                                                              

HsCD00041846      CCTGCGCCAATGCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAAGG
NM_002542.5       CCTGCGCCAATCCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAAGG
NM_016819.3       GGTGTCCTCCCTAG----------------------------------------------
NM_016821.2       GAAGGCCCCCCTATCGGGAGAGGGGATTCACAAGGTGAAGAACTGGAACCCCAGCTTCCC
NM_016829.2       ------------------------------------------------------------
NM_016820.3       CCTGCGCCAATCCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAAGG
NM_016828.2       CTCGGACCCCATAGGCTGGATCAGATGCCTCCTGAAGAATTACAG---------------
                                                                              

HsCD00041846      GCCGGAAGGCTTG-----------------------------------------------
NM_002542.5       GCCGGAAGGCTAG-----------------------------------------------
NM_016819.3       ------------------------------------------------------------
NM_016821.2       TCCAGCCTCTCCTCCATTCCCTATGGGTTCTGTGACCACTGCTGGACCAAGGACGTGGAT
NM_016829.2       ------------------------------------------------------------
NM_016820.3       GCCGGAAGGCTAGATGGGGCACCCTGGACAAAGAAATTCCCCAAGCACCTTCCCCTCCAT
NM_016828.2       -----------------------------------------------------------A
                                                                              

HsCD00041846      ------------------------------------------------------------
NM_002542.5       ------------------------------------------------------------
NM_016819.3       ------------------------------------------------------------
NM_016821.2       GACCCTCCCCTAGTCACTCATCCATCCCCTGGCTCCAGAGATGGTCACATGACCCAGGCC
NM_016829.2       ------------------------------------------------------------
NM_016820.3       TCCCCACTTCTCTCTCCCCATCCCCACCCAGTCTCATGTTGGGGAGGGGCCTCCCTGTGA
NM_016828.2       CTTCTTCCTCTAGACTTGGAGGGCCTCCTTGGCAATGCATTTGA----------------
                                                                              

HsCD00041846      ------------------------------------------------------------
NM_002542.5       ------------------------------------------------------------
NM_016819.3       ------------------------------------------------------------
NM_016821.2       TGGCCAGTCAAAGTAGTCTCTCCCCTGGCCACAGTAATTGGTCATGTGATGCAAGCCAGC
NM_016829.2       ------------------------------------------------------------
NM_016820.3       CTACCTCAAAGGCCAGGCACCCCCAAATCAAGCAGTCAG---TTTGCACAACAAGATGGG
NM_016828.2       ------------------------------------------------------------
                                                                              

HsCD00041846      ---------------
NM_002542.5       ---------------
NM_016819.3       ---------------
NM_016821.2       TTACTAGCACTTTGA
NM_016829.2       ---------------
NM_016820.3       GTGGGGGATATTGA-
NM_016828.2       ---------------
                                 

Pathways

NCI : Validated transcriptional targets of TAp63 isoforms
Reactome : Base Excision Repair
Reactome : Base-Excision Repair, AP Site Formation
Reactome : Base-free sugar-phosphate removal via the single-nucleotide replacement pathway
Reactome : Cleavage of the damaged purine
Reactome : DNA Repair
Reactome : Depurination
Reactome : Displacement of DNA glycosylase by APE1
Reactome : Recognition and association of DNA glycosylase with site containing an affected purine
Reactome : Removal of DNA patch containing abasic residue
Reactome : Resolution of AP sites via the multiple-nucleotide patch replacement pathway
Reactome : Resolution of AP sites via the single-nucleotide replacement pathway
Reactome : Resolution of Abasic Sites (AP sites)

Protein

SMART domain : ENDO3c : endonuclease III
UniProt : E5KPM7
UniProt : E5KPM6
UniProt : O15527
UniProt : E5KPM5
UniProt : E5KPM8
UniProt : E5KPM9
UniProt : E5KPN1
UniProt : E5KPN0
HPRD : 03582

Clone

Cloning Information : 190365
HIP Master Clone ID : 165309
Original Clone ID : FLH190365.01L

Organism


TAX_ID : 9606
Species Specific ID: 4968

Genome

Chromosome : 3
Map Location : 3p26.2
Ensembl : ENSG00000114026

Reagents

Labome : OGG1-antibody