DNASU Plasmid Repository • 480.965.5697 | Email

ASNS (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ASNS
Gene Name:  asparagine synthetase (glutamine-hydrolyzing)
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH191714.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00042002

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1686nts         Open reading frame : 1 to 1686
Reference Sequence Alignment

ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
ATGGTTAAATATCATCACTGTCGGGATGAACCCCTGCACGCCCTCTATGACAATGTGGAG
AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
GCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2051
Start on reference sequence 366
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ASNS
Symbol Nomenclature : ASNS
SYNONYM : ASNSD; TS11
Designation : TS11 cell cycle control protein|asparagine synthetase [glutamine-hydrolyzing]|glutamine-dependent asparagine synthetase
Full Nomenclature : asparagine synthetase (glutamine-hydrolyzing)
GENEID : 440
HGNC : 753
MIM : 108370
Vega : OTTHUMG00000022892
Target GenBank: BC008723

 

Reference Sequence Alignment

  

HsCD00042002        ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
NM_133436.3         ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
NM_001673.4         ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
NM_183356.3         ATGTGTGGCATTTGGGCGCTGTTTGGCAGTGATGATTGCCTTTCTGTTCAGTGTCTGAGT
NM_001178075.1      ------------------------------------------------------------
                                                                                

HsCD00042002        GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
NM_133436.3         GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
NM_001673.4         GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
NM_183356.3         GCTATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
NM_001178075.1      ---ATGAAGATTGCACACAGAGGTCCAGATGCATTCCGTTTTGAGAATGTCAATGGATAC
                       *********************************************************

HsCD00042002        ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
NM_133436.3         ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
NM_001673.4         ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
NM_183356.3         ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
NM_001178075.1      ACCAACTGCTGCTTTGGATTTCACCGGTTGGCGGTAGTTGACCCGCTGTTTGGAATGCAG
                    ************************************************************

HsCD00042002        CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
NM_133436.3         CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
NM_001673.4         CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
NM_183356.3         CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
NM_001178075.1      CCAATTCGAGTGAAGAAATATCCGTATTTGTGGCTCTGTTACAATGGTGAAATCTACAAC
                    ************************************************************

HsCD00042002        CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
NM_133436.3         CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
NM_001673.4         CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
NM_183356.3         CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
NM_001178075.1      CATAAGAAGATGCAACAGCATTTTGAATTTGAATACCAGACCAAAGTGGATGGTGAGATA
                    ************************************************************

HsCD00042002        ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
NM_133436.3         ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
NM_001673.4         ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
NM_183356.3         ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
NM_001178075.1      ATCCTTCATCTTTATGACAAAGGAGGAATTGAGCAAACAATTTGTATGTTGGATGGTGTG
                    ************************************************************

HsCD00042002        TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
NM_133436.3         TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
NM_001673.4         TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
NM_183356.3         TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
NM_001178075.1      TTTGCATTTGTTTTACTGGATACTGCCAATAAGAAAGTGTTCCTGGGTAGAGATACATAT
                    ************************************************************

HsCD00042002        GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
NM_133436.3         GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
NM_001673.4         GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
NM_183356.3         GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
NM_001178075.1      GGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCTGTATGTTCAGAA
                    ************************************************************

HsCD00042002        GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
NM_133436.3         GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
NM_001673.4         GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
NM_183356.3         GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
NM_001178075.1      GCTAAAGGTCTTGTTACATTGAAGCACTCCGCGACTCCCTTTTTAAAAGTGGAGCCTTTT
                    ************************************************************

HsCD00042002        CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
NM_133436.3         CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
NM_001673.4         CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
NM_183356.3         CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
NM_001178075.1      CTTCCTGGACACTATGAAGTTTTGGATTTAAAGCCAAATGGCAAAGTTGCATCCGTGGAA
                    ************************************************************

HsCD00042002        ATGGTTAAATATCATCACTGTCGGGATGAACCCCTGCACGCCCTCTATGACAATGTGGAG
NM_133436.3         ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
NM_001673.4         ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
NM_183356.3         ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
NM_001178075.1      ATGGTTAAATATCATCACTGTCGGGATGTACCCCTGCACGCCCTCTATGACAATGTGGAG
                    ****************************:*******************************

HsCD00042002        AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
NM_133436.3         AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
NM_001673.4         AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
NM_183356.3         AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
NM_001178075.1      AAACTCTTTCCAGGTTTTGAGATAGAAACTGTGAAGAACAACCTCAGGATCCTTTTTAAT
                    ************************************************************

HsCD00042002        AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
NM_133436.3         AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
NM_001673.4         AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
NM_183356.3         AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
NM_001178075.1      AATGCTGTAAAGAAACGTTTGATGACAGACAGAAGGATTGGCTGCCTTTTATCAGGGGGC
                    ************************************************************

HsCD00042002        TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
NM_133436.3         TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
NM_001673.4         TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
NM_183356.3         TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
NM_001178075.1      TTGGACTCCAGCTTGGTTGCTGCCACTCTGTTGAAGCAGCTGAAAGAAGCCCAAGTACAG
                    ************************************************************

HsCD00042002        TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
NM_133436.3         TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
NM_001673.4         TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
NM_183356.3         TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
NM_001178075.1      TATCCTCTCCAGACATTTGCAATTGGCATGGAAGACAGCCCCGATTTACTGGCTGCTAGA
                    ************************************************************

HsCD00042002        AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
NM_133436.3         AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
NM_001673.4         AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
NM_183356.3         AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
NM_001178075.1      AAGGTGGCAGATCATATTGGAAGTGAACATTATGAAGTCCTTTTTAACTCTGAGGAAGGC
                    ************************************************************

HsCD00042002        ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
NM_133436.3         ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
NM_001673.4         ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
NM_183356.3         ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
NM_001178075.1      ATTCAGGCTCTGGATGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTTCGT
                    ************************************************************

HsCD00042002        GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
NM_133436.3         GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
NM_001673.4         GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
NM_183356.3         GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
NM_001178075.1      GCTTCAGTAGGTATGTATTTAATTTCCAAGTATATTCGGAAGAACACAGATAGCGTGGTG
                    ************************************************************

HsCD00042002        ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
NM_133436.3         ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
NM_001673.4         ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
NM_183356.3         ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
NM_001178075.1      ATCTTCTCTGGAGAAGGATCAGATGAACTTACGCAGGGTTACATATATTTTCACAAGGCT
                    ************************************************************

HsCD00042002        CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
NM_133436.3         CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
NM_001673.4         CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
NM_183356.3         CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
NM_001178075.1      CCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAGGGAACTCTATTTGTTT
                    ************************************************************

HsCD00042002        GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
NM_133436.3         GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
NM_001673.4         GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
NM_183356.3         GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
NM_001178075.1      GATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGTCTTGAACTGAGAGTCCCATTT
                    ************************************************************

HsCD00042002        CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
NM_133436.3         CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
NM_001673.4         CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
NM_183356.3         CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
NM_001178075.1      CTAGATCATCGATTTTCTTCCTATTACTTGTCTCTGCCACCAGAAATGAGAATTCCAAAG
                    ************************************************************

HsCD00042002        AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
NM_133436.3         AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
NM_001673.4         AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
NM_183356.3         AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
NM_001178075.1      AATGGGATAGAAAAACATCTCCTGAGAGAGACGTTTGAGGATTCCAATCTGATACCCAAA
                    ************************************************************

HsCD00042002        GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
NM_133436.3         GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
NM_001673.4         GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
NM_183356.3         GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
NM_001178075.1      GAGATTCTCTGGCGACCAAAAGAAGCCTTCAGTGATGGAATAACTTCAGTTAAGAATTCC
                    ************************************************************

HsCD00042002        TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
NM_133436.3         TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
NM_001673.4         TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
NM_183356.3         TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
NM_001178075.1      TGGTTTAAGATTTTACAGGAATACGTTGAACATCAGGTTGATGATGCAATGATGGCAAAT
                    ************************************************************

HsCD00042002        GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
NM_133436.3         GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
NM_001673.4         GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
NM_183356.3         GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
NM_001178075.1      GCAGCCCAGAAATTTCCCTTCAATACTCCTAAAACCAAAGAAGGATATTACTACCGTCAA
                    ************************************************************

HsCD00042002        GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
NM_133436.3         GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
NM_001673.4         GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
NM_183356.3         GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
NM_001178075.1      GTCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGAGCCATTACTGGATGCCCAAG
                    ************************************************************

HsCD00042002        TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
NM_133436.3         TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
NM_001673.4         TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
NM_183356.3         TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
NM_001178075.1      TGGATCAATGCCACTGACCCTTCTGCCCGCACGCTGACCCACTACAAGTCAGCTGTCAAA
                    ************************************************************

HsCD00042002        GCTTTG
NM_133436.3         GCTTAG
NM_001673.4         GCTTAG
NM_183356.3         GCTTAG
NM_001178075.1      GCTTAG
                    ****:*

Pathways

Panther : Asparagine and aspartate biosynthesis
Reactome : ATF4 activates genes
Reactome : Amino acid synthesis and interconversion (transamination)
Reactome : Metabolism
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of proteins
Reactome : PERK regulates gene expression
Reactome : Unfolded Protein Response (UPR)

Protein

UniProt : P08243
UniProt : E9PCX6
UniProt : B4DXZ1
UniProt : E9PCI3
HPRD : 00153

Clone

Cloning Information : 191714
HIP Master Clone ID : 166658
Original Clone ID : FLH191714.01L

Organism


TAX_ID : 9606
Species Specific ID: 440

Genome

Chromosome : 7
Map Location : 7q21.3
Ensembl : ENSG00000070669