DNASU Plasmid Repository • 480.965.5697 | Email

CPSF1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CPSF1
Gene Name:  cleavage and polyadenylation specific factor 1, 160kDa
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH193594.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00042068

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 4332nts         Open reading frame : 1 to 4332
Reference Sequence Alignment

ATGTACGCCGTGTACAAACAGGCGCATCCGCCCACCGGTCTGGAGTTCTCCATGTACTGC
AACTTCTTCAACAACAGCGAGCGCAACCTGGTAGTGGCCGGGACCTCGCAGCTCTACGTG
TACCGCCTCAACCGCGACGCCGAGGCTCTGACCAAGAATGACAGGAGCACAGAGGGGAAG
GCCCACCGGGAGAAGCTCGAGCTTGCTGCCTCCTTCTCCTTCTTTGGCAACGTCATGTCC
ATGGCCAGCGTGCAGCTGGCAGGAGCCAAGCGGGATGCCCTGCTCCTAAGCTTCAAGGAT
GCCAAGCTGTCTGTGGTGGAGTACGACCCGGGCACCCATGACCTGAAGACCCTGTCACTG
CACTACTTTGAGGAGCCTGAGCTTCGGGACGGGTTTGTGCAGAATGTACACACGCCGCGA
GTGCGGGTGGACCCCGACGGGCGCTGTGCAGCCATGCTTGTCTACGGCACGCGGCTGGTG
GTCCTGCCCTTCCGCAGGGAGAGCCTGGCTGAGGAGCACGAGGGGCTCGTGGGTGAGGGG
CAGAGGTCCAGCTTCCTGCCCAGCTACATCATCGACGTGCGGGCCCTAGACGAGAAGCTG
CTCAACATCATCGACCTGCAGTTCCTGCATGGCTACTACGAGCCTACCCTCCTCATCCTG
TTTGAGCCCAACCAGACCTGGCCTGGGCGCGTGGCCGTGCGGCAGGACACGTGCTCCATT
GTGGCCATCTCACTGAACATCACGCAGAAGGTGCACCCCGTCATCTGGTCCCTCACCAGC
CTGCCCTTTGACTGCACCCAGGCTCTGGCTGTGCCCAAGCCCATAGGTGGGGTGGTGGTG
TTTGCCGTCAACTCGCTGTTGTACCTGAACCAGAGCGTCCCCCCGTATGGCGTGGCTCTC
AACAGCCTCACCACAGGAACCACGGCTTTCCCGCTTCGCACCCAGGAGGGTGTGCGGATC
ACCCTGGACTGCGCCCAGGCCACCTTCATCTCCTACGACAAGATGGTCATCTCCCTCAAG
GGCGGCGAGATCTACGTGCTGACCCTCATCACCGACGGCATGCGCAGTGTCCGAGCGTTC
CACTTTGACAAGGCGGCCGCCAGCGTCCTCACCACCAGCATGGTCACCATGGAGCCCGGG
TACCTGTTCCTGGGTTCTCGCCTGGGCAATTCCCTCCTCCTCAAGTACACGGAGAAGCTG
CAGGAGCCCCCGGCCAGTGCTGTCCGTGAGGCTGCCGACAAGGAAGAGCCTCCCTCAAAG
AAGAAGCGAGTGGATGCGACGGCCGGCTGGTCAGCTGCGGGTAAGTCGGTGCCGCAGGAT
GAGGTGGACGAGATTGAAGTGTACGGCAGCGAGGCCCAGTCGGGAACACAGCTGGCCACC
TACTCCTTTGAGGTGTGTGACAGCATCCTGAACATTGGACCCTGTGCCAATGCCGCCGTG
GGCGAGCCTGCCTTCCTCTCTGAAGAGTTTCAGAACAGCCCCGAGCCGGACCTGGAGATT
GTGGTTTGCTCCGGCCACGGGAAGAACGGGGCTTTGTCGGTGCTGCAGAAGAGCATCCGG
CCCCAGGTGGTGACAACCTTTGAGCTTCCCGGCTGCTATGACATGTGGACAGTCATCGCC
CCGGTGCGTAAGGAGGAGGAGGACAATCCCAAGGGGGAGGGCACAGAGCAGGAACCCAGC
ACCACCCCTGAAGCAGACGACGACGGCCGCAGACACGGATTCCTGATTCTGAGCCGGGAA
GACTCCACCATGATCCTGCAGACGGGGCAGGAGATCATGGAGCTGGACACCAGTGGCTTC
GCCACTCAGGGCCCCACGGTCTTTGCTGGGAACATCGGGGACAACCGCTACATTGTCCAA
GTGTCACCACTGGGCATCCGCCTGCTGGAAGGAGTGAATCAGCTGCACTTCATCCCCGTG
GACCTGGGCGCCCCCATCGTGCAGTGCGCCGTGGCCGACCCCTATGTGGTCATCATGAGT
GCCGAGGGCCACGTCACCATGTTCCTGCTGAAGAGTGACTCCTACGGTGGCCGCCACCAC
CGCCTGGCGCTGCACAAGCCCCCGCTGCACCATCAGTCCAAGGTGATTACGCTGTGCCTG
TACCGAGACCTCAGCGGCATGTTCACCACTGAGAGCCGCCTGGGTGGGGCCCGTGACGAG
CTCGGGGGCCGCAGTGGCCCGGAGGCCGAGGGCCTGGGCTCAGAGACTAGCCCCACAGTG
GATGACGAGGAGGAGATGCTGTATGGGGATTCGGGCTCCCTCTTCAGCCCCAGCAAGGAG
GAGGCCCGAAGAAGCAGCCAGCCCCCTGCTGACCGGGACCCTGCACCCTTCCGGGCAGAG
CCTACCCACTGGTGCCTGCTGGTGCGGGAGAATGGCACCATGGAGATCTACCAGCTTCCC
GACTGGCGGCTGGTGTTCCTGGTGAAGAACTTCCCTGTGGGGCAGCGGGTCCTTGTGGAC
AGCTCCTTTGGACAGCCCACTACACAGGGCGAGGCCCGCAGGGAGGAGGCCACGCGCCAG
GGGGAGCTGCCCCTCGTCAAGGAGGTGCTGCTGGTGGCGCTGGGCAGCCGCCAGAGCAGG
CCCTACCTGCTGGTGCATGTGGACCAAGAGCTGCTTATCTACGAGGCCTTCCCCCACGAC
TCTCAGCTCGGCCAGGGCAATCTCAAAGTCCGCTTTAAGAAGGTCCCTCACAACATCAAC
TTCCGTGAGAAGAAGCCAAAGCCATCCAAGAAGAAAGCAGAAGGTGGCGGCGCAGAGGAG
GGGGCTGGGGCCCGGGGCCGCGTGGCGCGTTTCCGCTACTTCGAGGATATTTATGGCTAC
TCAGGGGTCTTCATCTGCGGCCCCTCCCCTCACTGGCTCTTGGTGACCGGCCGAGGGGCT
CTGCGGCTACACCCCATGGCCATCGACGGCCCGGTCGACTCTTTCGCTCCATTCCACAAT
GTCAACTGTCCCCGCGGCTTCCTGTACTTCAACAGACAGGGCGAGCTGAGGATCAGTGTC
CTGCCTGCCTACCTGTCCTATGATGCCCCATGGCCTGTCAGGAAGATCCCGCTGCGCTGC
ACGGCCCACTATGTGGCTTACCACGTGGAGTCTAAGGTGTATGCTGTGGCCACCAGCACC
AACACGCCGTGTGCCCGCATCCCACGCATGACTGGCGAGGAGAAGGAGTTTGAGACCATC
GAGAGAGATGAGCGGTACATCCACCCCCAGCAGGAGGCCTTCTCCATCCAGCTCATCTCC
CCGGTCAGCTGGGAGGCTATTCCCAATGCCAGGATCGAGCTGCAGGAGTGGGAGCATGTG
ACCTGCATGAAGACAGTGTCTCTGCGCAGTGAGGAGACCGTGTCGGGCCTCAAAGGCTAC
GTGGCCGCCGGGACCTGCCTCATGCAGGGGGAGGAGGTCACGTGCCGAGGGCGGATCTTG
ATCATGGATGTGATTGAGGTGGTGCCCGAGCCTGGCCAGCCCTTGACCAAGAACAAGTTC
AAAGTCCTTTACGAGAAGGAGCAGAAGGGGCCCGTGACCGCCCTGTGCCACTGCAATGGC
CACCTGGTGTCGGCCATCGGCCAGAAGATTTTCCTGTGGAGCCTGCGGGCCAGCGAGCTG
ACGGGCATGGCCTTCATCGACACGCAGCTCTACATACACCAGATGATCAGCGTCAAGAAC
TTCATCCTGGCAGCCGACGTCATGAAGAGCATTTCGCTGCTGCGCTACCAGGAGGAAAGC
AAGACGCTGAGCCTGGTGTCGCGGGATGCCAAGCCCCTGGAGGTGTACAGCGTGGACTTC
ATGGTGGACAATGCCCAGCTGGGTTTTCTGGTGTCTGACCGCGACCGCAACCTCATGGTG
TACATGTACCTGCCCGAAGCCAAGGAGAGTTTCGGGGGCATGCGCCTGCTGCGTCGGGCA
GACTTCCACGTGGGTGCCCACGTGAACACGTTCTGGAGGACCCCGTGCCGGGGGGCCACT
GAAGGGCTCAGCAAAAAGTCGGTCGTGTGGGAGAATAAGCACATCACGTGGTTTGCCACC
CTGGACGGCGGCATCGGGCTGCTGCTGCCCATGCAGGAGAAGACCTACCGGCGGCTGCTG
ATGCTGCAGAACGCGCTGACCACCATGCTGCCACACCACGCCGGCCTCAACCCCCGCGCC
TTCCGGATGCTGCACGTGGACCGCCGCACCCTCCAGAATGCCGTGCGCAACGTGCTGGAT
GGGGAGCTGCTCAACCGCTACCTGTACCTGAGCACCATGGAGCGCAGCGAGCTAGCCAAG
AAGATCGGCACCACACCAGACATAATCCTGGACGACTTGCTGGAGACGGACCGCGTCACC
GCCCACTTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 4386
Start on reference sequence 55
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CPSF1
Symbol Nomenclature : CPSF1
SYNONYM : CPSF160; HSU37012; P/cl.18
Designation : CPSF 160 kDa subunit|cleavage and polyadenylation specificity factor 160 kDa subunit|cleavage and polyadenylation specificity factor subunit 1|polyadenylation specificity factor
Full Nomenclature : cleavage and polyadenylation specific factor 1, 160kDa
GENEID : 29894
HGNC : 2324
MIM : 606027
Vega : OTTHUMG00000165170
Target GenBank: BC017232

 

Reference Sequence Alignment

  

HsCD00042068      ATGTACGCCGTGTACAAACAGGCGCATCCGCCCACCGGTCTGGAGTTCTCCATGTACTGC
NM_013291.2       ATGTACGCCGTGTACAAACAGGCGCATCCGCCCACCGGTCTGGAGTTCTCCATGTACTGC
                  ************************************************************

HsCD00042068      AACTTCTTCAACAACAGCGAGCGCAACCTGGTAGTGGCCGGGACCTCGCAGCTCTACGTG
NM_013291.2       AACTTCTTCAACAACAGCGAGCGCAACCTGGTAGTGGCCGGGACCTCGCAGCTCTACGTG
                  ************************************************************

HsCD00042068      TACCGCCTCAACCGCGACGCCGAGGCTCTGACCAAGAATGACAGGAGCACAGAGGGGAAG
NM_013291.2       TACCGCCTCAACCGCGACGCCGAGGCTCTGACCAAGAATGACAGGAGCACAGAGGGGAAG
                  ************************************************************

HsCD00042068      GCCCACCGGGAGAAGCTCGAGCTTGCTGCCTCCTTCTCCTTCTTTGGCAACGTCATGTCC
NM_013291.2       GCCCACCGGGAGAAGCTCGAGCTTGCTGCCTCCTTCTCCTTCTTTGGCAACGTCATGTCC
                  ************************************************************

HsCD00042068      ATGGCCAGCGTGCAGCTGGCAGGAGCCAAGCGGGATGCCCTGCTCCTAAGCTTCAAGGAT
NM_013291.2       ATGGCCAGCGTGCAGCTGGCAGGAGCCAAGCGGGATGCCCTGCTCCTAAGCTTCAAGGAT
                  ************************************************************

HsCD00042068      GCCAAGCTGTCTGTGGTGGAGTACGACCCGGGCACCCATGACCTGAAGACCCTGTCACTG
NM_013291.2       GCCAAGCTGTCTGTGGTGGAGTACGACCCGGGCACCCATGACCTGAAGACCCTGTCACTG
                  ************************************************************

HsCD00042068      CACTACTTTGAGGAGCCTGAGCTTCGGGACGGGTTTGTGCAGAATGTACACACGCCGCGA
NM_013291.2       CACTACTTTGAGGAGCCTGAGCTTCGGGACGGGTTTGTGCAGAATGTACACACGCCGCGA
                  ************************************************************

HsCD00042068      GTGCGGGTGGACCCCGACGGGCGCTGTGCAGCCATGCTTGTCTACGGCACGCGGCTGGTG
NM_013291.2       GTGCGGGTGGACCCCGACGGGCGCTGTGCAGCCATGCTTGTCTACGGCACGCGGCTGGTG
                  ************************************************************

HsCD00042068      GTCCTGCCCTTCCGCAGGGAGAGCCTGGCTGAGGAGCACGAGGGGCTCGTGGGTGAGGGG
NM_013291.2       GTCCTGCCCTTCCGCAGGGAGAGCCTGGCTGAGGAGCACGAGGGGCTCGTGGGTGAGGGG
                  ************************************************************

HsCD00042068      CAGAGGTCCAGCTTCCTGCCCAGCTACATCATCGACGTGCGGGCCCTAGACGAGAAGCTG
NM_013291.2       CAGAGGTCCAGCTTCCTGCCCAGCTACATCATCGACGTGCGGGCCCTAGACGAGAAGCTG
                  ************************************************************

HsCD00042068      CTCAACATCATCGACCTGCAGTTCCTGCATGGCTACTACGAGCCTACCCTCCTCATCCTG
NM_013291.2       CTCAACATCATCGACCTGCAGTTCCTGCATGGCTACTACGAGCCTACCCTCCTCATCCTG
                  ************************************************************

HsCD00042068      TTTGAGCCCAACCAGACCTGGCCTGGGCGCGTGGCCGTGCGGCAGGACACGTGCTCCATT
NM_013291.2       TTTGAGCCCAACCAGACCTGGCCTGGGCGCGTGGCCGTGCGGCAGGACACGTGCTCCATT
                  ************************************************************

HsCD00042068      GTGGCCATCTCACTGAACATCACGCAGAAGGTGCACCCCGTCATCTGGTCCCTCACCAGC
NM_013291.2       GTGGCCATCTCACTGAACATCACGCAGAAGGTGCACCCCGTCATCTGGTCCCTCACCAGC
                  ************************************************************

HsCD00042068      CTGCCCTTTGACTGCACCCAGGCTCTGGCTGTGCCCAAGCCCATAGGTGGGGTGGTGGTG
NM_013291.2       CTGCCCTTTGACTGCACCCAGGCTCTGGCTGTGCCCAAGCCCATAGGTGGGGTGGTGGTG
                  ************************************************************

HsCD00042068      TTTGCCGTCAACTCGCTGTTGTACCTGAACCAGAGCGTCCCCCCGTATGGCGTGGCTCTC
NM_013291.2       TTTGCCGTCAACTCGCTGTTGTACCTGAACCAGAGCGTCCCCCCGTATGGCGTGGCTCTC
                  ************************************************************

HsCD00042068      AACAGCCTCACCACAGGAACCACGGCTTTCCCGCTTCGCACCCAGGAGGGTGTGCGGATC
NM_013291.2       AACAGCCTCACCACAGGAACCACGGCTTTCCCGCTTCGCACCCAGGAGGGTGTGCGGATC
                  ************************************************************

HsCD00042068      ACCCTGGACTGCGCCCAGGCCACCTTCATCTCCTACGACAAGATGGTCATCTCCCTCAAG
NM_013291.2       ACCCTGGACTGCGCCCAGGCCACCTTCATCTCCTACGACAAGATGGTCATCTCCCTCAAG
                  ************************************************************

HsCD00042068      GGCGGCGAGATCTACGTGCTGACCCTCATCACCGACGGCATGCGCAGTGTCCGAGCGTTC
NM_013291.2       GGCGGCGAGATCTACGTGCTGACCCTCATCACCGACGGCATGCGCAGTGTCCGAGCGTTC
                  ************************************************************

HsCD00042068      CACTTTGACAAGGCGGCCGCCAGCGTCCTCACCACCAGCATGGTCACCATGGAGCCCGGG
NM_013291.2       CACTTTGACAAGGCGGCCGCCAGCGTCCTCACCACCAGCATGGTCACCATGGAGCCCGGG
                  ************************************************************

HsCD00042068      TACCTGTTCCTGGGTTCTCGCCTGGGCAATTCCCTCCTCCTCAAGTACACGGAGAAGCTG
NM_013291.2       TACCTGTTCCTGGGTTCTCGCCTGGGCAATTCCCTCCTCCTCAAGTACACGGAGAAGCTG
                  ************************************************************

HsCD00042068      CAGGAGCCCCCGGCCAGTGCTGTCCGTGAGGCTGCCGACAAGGAAGAGCCTCCCTCAAAG
NM_013291.2       CAGGAGCCCCCGGCCAGTGCTGTCCGTGAGGCTGCCGACAAGGAAGAGCCTCCCTCAAAG
                  ************************************************************

HsCD00042068      AAGAAGCGAGTGGATGCGACGGCCGGCTGGTCAGCTGCGGGTAAGTCGGTGCCGCAGGAT
NM_013291.2       AAGAAGCGAGTGGATGCGACGGCCGGCTGGTCAGCTGCGGGTAAGTCGGTGCCGCAGGAT
                  ************************************************************

HsCD00042068      GAGGTGGACGAGATTGAAGTGTACGGCAGCGAGGCCCAGTCGGGAACACAGCTGGCCACC
NM_013291.2       GAGGTGGACGAGATTGAAGTGTACGGCAGCGAGGCCCAGTCGGGAACACAGCTGGCCACC
                  ************************************************************

HsCD00042068      TACTCCTTTGAGGTGTGTGACAGCATCCTGAACATTGGACCCTGTGCCAATGCCGCCGTG
NM_013291.2       TACTCCTTTGAGGTGTGTGACAGCATCCTGAACATTGGACCCTGTGCCAATGCCGCCGTG
                  ************************************************************

HsCD00042068      GGCGAGCCTGCCTTCCTCTCTGAAGAGTTTCAGAACAGCCCCGAGCCGGACCTGGAGATT
NM_013291.2       GGCGAGCCTGCCTTCCTCTCTGAAGAGTTTCAGAACAGCCCCGAGCCGGACCTGGAGATT
                  ************************************************************

HsCD00042068      GTGGTTTGCTCCGGCCACGGGAAGAACGGGGCTTTGTCGGTGCTGCAGAAGAGCATCCGG
NM_013291.2       GTGGTTTGCTCCGGCCACGGGAAGAACGGGGCTTTGTCGGTGCTGCAGAAGAGCATCCGG
                  ************************************************************

HsCD00042068      CCCCAGGTGGTGACAACCTTTGAGCTTCCCGGCTGCTATGACATGTGGACAGTCATCGCC
NM_013291.2       CCCCAGGTGGTGACAACCTTTGAGCTTCCCGGCTGCTATGACATGTGGACAGTCATCGCC
                  ************************************************************

HsCD00042068      CCGGTGCGTAAGGAGGAGGAGGACAATCCCAAGGGGGAGGGCACAGAGCAGGAACCCAGC
NM_013291.2       CCGGTGCGTAAGGAGGAGGAGGACAATCCCAAGGGGGAGGGCACAGAGCAGGAACCCAGC
                  ************************************************************

HsCD00042068      ACCACCCCTGAAGCAGACGACGACGGCCGCAGACACGGATTCCTGATTCTGAGCCGGGAA
NM_013291.2       ACCACCCCTGAAGCAGACGACGACGGCCGCAGACACGGATTCCTGATTCTGAGCCGGGAA
                  ************************************************************

HsCD00042068      GACTCCACCATGATCCTGCAGACGGGGCAGGAGATCATGGAGCTGGACACCAGTGGCTTC
NM_013291.2       GACTCCACCATGATCCTGCAGACGGGGCAGGAGATCATGGAGCTGGACACCAGTGGCTTC
                  ************************************************************

HsCD00042068      GCCACTCAGGGCCCCACGGTCTTTGCTGGGAACATCGGGGACAACCGCTACATTGTCCAA
NM_013291.2       GCCACTCAGGGCCCCACGGTCTTTGCTGGGAACATCGGGGACAACCGCTACATTGTCCAA
                  ************************************************************

HsCD00042068      GTGTCACCACTGGGCATCCGCCTGCTGGAAGGAGTGAATCAGCTGCACTTCATCCCCGTG
NM_013291.2       GTGTCACCACTGGGCATCCGCCTGCTGGAAGGAGTGAATCAGCTGCACTTCATCCCCGTG
                  ************************************************************

HsCD00042068      GACCTGGGCGCCCCCATCGTGCAGTGCGCCGTGGCCGACCCCTATGTGGTCATCATGAGT
NM_013291.2       GACCTGGGCGCCCCCATCGTGCAGTGCGCCGTGGCCGACCCCTATGTGGTCATCATGAGT
                  ************************************************************

HsCD00042068      GCCGAGGGCCACGTCACCATGTTCCTGCTGAAGAGTGACTCCTACGGTGGCCGCCACCAC
NM_013291.2       GCCGAGGGCCACGTCACCATGTTCCTGCTGAAGAGTGACTCCTACGGTGGCCGCCACCAC
                  ************************************************************

HsCD00042068      CGCCTGGCGCTGCACAAGCCCCCGCTGCACCATCAGTCCAAGGTGATTACGCTGTGCCTG
NM_013291.2       CGCCTGGCGCTGCACAAGCCCCCGCTGCACCATCAGTCCAAGGTGATTACGCTGTGCCTG
                  ************************************************************

HsCD00042068      TACCGAGACCTCAGCGGCATGTTCACCACTGAGAGCCGCCTGGGTGGGGCCCGTGACGAG
NM_013291.2       TACCGAGACCTCAGCGGCATGTTCACCACTGAGAGCCGCCTGGGTGGGGCCCGTGACGAG
                  ************************************************************

HsCD00042068      CTCGGGGGCCGCAGTGGCCCGGAGGCCGAGGGCCTGGGCTCAGAGACTAGCCCCACAGTG
NM_013291.2       CTCGGGGGCCGCAGTGGCCCGGAGGCCGAGGGCCTGGGCTCAGAGACTAGCCCCACAGTG
                  ************************************************************

HsCD00042068      GATGACGAGGAGGAGATGCTGTATGGGGATTCGGGCTCCCTCTTCAGCCCCAGCAAGGAG
NM_013291.2       GATGACGAGGAGGAGATGCTGTATGGGGATTCGGGCTCCCTCTTCAGCCCCAGCAAGGAG
                  ************************************************************

HsCD00042068      GAGGCCCGAAGAAGCAGCCAGCCCCCTGCTGACCGGGACCCTGCACCCTTCCGGGCAGAG
NM_013291.2       GAGGCCCGAAGAAGCAGCCAGCCCCCTGCTGACCGGGACCCTGCACCCTTCCGGGCAGAG
                  ************************************************************

HsCD00042068      CCTACCCACTGGTGCCTGCTGGTGCGGGAGAATGGCACCATGGAGATCTACCAGCTTCCC
NM_013291.2       CCTACCCACTGGTGCCTGCTGGTGCGGGAGAATGGCACCATGGAGATCTACCAGCTTCCC
                  ************************************************************

HsCD00042068      GACTGGCGGCTGGTGTTCCTGGTGAAGAACTTCCCTGTGGGGCAGCGGGTCCTTGTGGAC
NM_013291.2       GACTGGCGGCTGGTGTTCCTGGTGAAGAACTTCCCTGTGGGGCAGCGGGTCCTTGTGGAC
                  ************************************************************

HsCD00042068      AGCTCCTTTGGACAGCCCACTACACAGGGCGAGGCCCGCAGGGAGGAGGCCACGCGCCAG
NM_013291.2       AGCTCCTTTGGACAGCCCACTACACAGGGCGAGGCCCGCAGGGAGGAGGCCACGCGCCAG
                  ************************************************************

HsCD00042068      GGGGAGCTGCCCCTCGTCAAGGAGGTGCTGCTGGTGGCGCTGGGCAGCCGCCAGAGCAGG
NM_013291.2       GGGGAGCTGCCCCTCGTCAAGGAGGTGCTGCTGGTGGCGCTGGGCAGCCGCCAGAGCAGG
                  ************************************************************

HsCD00042068      CCCTACCTGCTGGTGCATGTGGACCAAGAGCTGCTTATCTACGAGGCCTTCCCCCACGAC
NM_013291.2       CCCTACCTGCTGGTGCATGTGGACCAAGAGCTGCTTATCTACGAGGCCTTCCCCCACGAC
                  ************************************************************

HsCD00042068      TCTCAGCTCGGCCAGGGCAATCTCAAAGTCCGCTTTAAGAAGGTCCCTCACAACATCAAC
NM_013291.2       TCTCAGCTCGGCCAGGGCAATCTCAAAGTCCGCTTTAAGAAGGTCCCTCACAACATCAAC
                  ************************************************************

HsCD00042068      TTCCGTGAGAAGAAGCCAAAGCCATCCAAGAAGAAAGCAGAAGGTGGCGGCGCAGAGGAG
NM_013291.2       TTCCGTGAGAAGAAGCCAAAGCCATCCAAGAAGAAAGCAGAAGGTGGCGGCGCAGAGGAG
                  ************************************************************

HsCD00042068      GGGGCTGGGGCCCGGGGCCGCGTGGCGCGTTTCCGCTACTTCGAGGATATTTATGGCTAC
NM_013291.2       GGGGCTGGGGCCCGGGGCCGCGTGGCGCGTTTCCGCTACTTCGAGGATATTTATGGCTAC
                  ************************************************************

HsCD00042068      TCAGGGGTCTTCATCTGCGGCCCCTCCCCTCACTGGCTCTTGGTGACCGGCCGAGGGGCT
NM_013291.2       TCAGGGGTCTTCATCTGCGGCCCCTCCCCTCACTGGCTCTTGGTGACCGGCCGAGGGGCT
                  ************************************************************

HsCD00042068      CTGCGGCTACACCCCATGGCCATCGACGGCCCGGTCGACTCTTTCGCTCCATTCCACAAT
NM_013291.2       CTGCGGCTACACCCCATGGCCATCGACGGCCCGGTCGACTCTTTCGCTCCATTCCACAAT
                  ************************************************************

HsCD00042068      GTCAACTGTCCCCGCGGCTTCCTGTACTTCAACAGACAGGGCGAGCTGAGGATCAGTGTC
NM_013291.2       GTCAACTGTCCCCGCGGCTTCCTGTACTTCAACAGACAGGGCGAGCTGAGGATCAGTGTC
                  ************************************************************

HsCD00042068      CTGCCTGCCTACCTGTCCTATGATGCCCCATGGCCTGTCAGGAAGATCCCGCTGCGCTGC
NM_013291.2       CTGCCTGCCTACCTGTCCTATGATGCCCCATGGCCTGTCAGGAAGATCCCGCTGCGCTGC
                  ************************************************************

HsCD00042068      ACGGCCCACTATGTGGCTTACCACGTGGAGTCTAAGGTGTATGCTGTGGCCACCAGCACC
NM_013291.2       ACGGCCCACTATGTGGCTTACCACGTGGAGTCTAAGGTGTATGCTGTGGCCACCAGCACC
                  ************************************************************

HsCD00042068      AACACGCCGTGTGCCCGCATCCCACGCATGACTGGCGAGGAGAAGGAGTTTGAGACCATC
NM_013291.2       AACACGCCGTGTGCCCGCATCCCACGCATGACTGGCGAGGAGAAGGAGTTTGAGACCATC
                  ************************************************************

HsCD00042068      GAGAGAGATGAGCGGTACATCCACCCCCAGCAGGAGGCCTTCTCCATCCAGCTCATCTCC
NM_013291.2       GAGAGAGATGAGCGGTACATCCACCCCCAGCAGGAGGCCTTCTCCATCCAGCTCATCTCC
                  ************************************************************

HsCD00042068      CCGGTCAGCTGGGAGGCTATTCCCAATGCCAGGATCGAGCTGCAGGAGTGGGAGCATGTG
NM_013291.2       CCGGTCAGCTGGGAGGCTATTCCCAATGCCAGGATCGAGCTGCAGGAGTGGGAGCATGTG
                  ************************************************************

HsCD00042068      ACCTGCATGAAGACAGTGTCTCTGCGCAGTGAGGAGACCGTGTCGGGCCTCAAAGGCTAC
NM_013291.2       ACCTGCATGAAGACAGTGTCTCTGCGCAGTGAGGAGACCGTGTCGGGCCTCAAAGGCTAC
                  ************************************************************

HsCD00042068      GTGGCCGCCGGGACCTGCCTCATGCAGGGGGAGGAGGTCACGTGCCGAGGGCGGATCTTG
NM_013291.2       GTGGCCGCCGGGACCTGCCTCATGCAGGGGGAGGAGGTCACGTGCCGAGGGCGGATCTTG
                  ************************************************************

HsCD00042068      ATCATGGATGTGATTGAGGTGGTGCCCGAGCCTGGCCAGCCCTTGACCAAGAACAAGTTC
NM_013291.2       ATCATGGATGTGATTGAGGTGGTGCCCGAGCCTGGCCAGCCCTTGACCAAGAACAAGTTC
                  ************************************************************

HsCD00042068      AAAGTCCTTTACGAGAAGGAGCAGAAGGGGCCCGTGACCGCCCTGTGCCACTGCAATGGC
NM_013291.2       AAAGTCCTTTACGAGAAGGAGCAGAAGGGGCCCGTGACCGCCCTGTGCCACTGCAATGGC
                  ************************************************************

HsCD00042068      CACCTGGTGTCGGCCATCGGCCAGAAGATTTTCCTGTGGAGCCTGCGGGCCAGCGAGCTG
NM_013291.2       CACCTGGTGTCGGCCATCGGCCAGAAGATTTTCCTGTGGAGCCTGCGGGCCAGCGAGCTG
                  ************************************************************

HsCD00042068      ACGGGCATGGCCTTCATCGACACGCAGCTCTACATACACCAGATGATCAGCGTCAAGAAC
NM_013291.2       ACGGGCATGGCCTTCATCGACACGCAGCTCTACATACACCAGATGATCAGCGTCAAGAAC
                  ************************************************************

HsCD00042068      TTCATCCTGGCAGCCGACGTCATGAAGAGCATTTCGCTGCTGCGCTACCAGGAGGAAAGC
NM_013291.2       TTCATCCTGGCAGCCGACGTCATGAAGAGCATTTCGCTGCTGCGCTACCAGGAGGAAAGC
                  ************************************************************

HsCD00042068      AAGACGCTGAGCCTGGTGTCGCGGGATGCCAAGCCCCTGGAGGTGTACAGCGTGGACTTC
NM_013291.2       AAGACGCTGAGCCTGGTGTCGCGGGATGCCAAGCCCCTGGAGGTGTACAGCGTGGACTTC
                  ************************************************************

HsCD00042068      ATGGTGGACAATGCCCAGCTGGGTTTTCTGGTGTCTGACCGCGACCGCAACCTCATGGTG
NM_013291.2       ATGGTGGACAATGCCCAGCTGGGTTTTCTGGTGTCTGACCGCGACCGCAACCTCATGGTG
                  ************************************************************

HsCD00042068      TACATGTACCTGCCCGAAGCCAAGGAGAGTTTCGGGGGCATGCGCCTGCTGCGTCGGGCA
NM_013291.2       TACATGTACCTGCCCGAAGCCAAGGAGAGTTTCGGGGGCATGCGCCTGCTGCGTCGGGCA
                  ************************************************************

HsCD00042068      GACTTCCACGTGGGTGCCCACGTGAACACGTTCTGGAGGACCCCGTGCCGGGGGGCCACT
NM_013291.2       GACTTCCACGTGGGTGCCCACGTGAACACGTTCTGGAGGACCCCGTGCCGGGGGGCCACT
                  ************************************************************

HsCD00042068      GAAGGGCTCAGCAAAAAGTCGGTCGTGTGGGAGAATAAGCACATCACGTGGTTTGCCACC
NM_013291.2       GAAGGGCTCAGCAAAAAGTCGGTCGTGTGGGAGAATAAGCACATCACGTGGTTTGCCACC
                  ************************************************************

HsCD00042068      CTGGACGGCGGCATCGGGCTGCTGCTGCCCATGCAGGAGAAGACCTACCGGCGGCTGCTG
NM_013291.2       CTGGACGGCGGCATCGGGCTGCTGCTGCCCATGCAGGAGAAGACCTACCGGCGGCTGCTG
                  ************************************************************

HsCD00042068      ATGCTGCAGAACGCGCTGACCACCATGCTGCCACACCACGCCGGCCTCAACCCCCGCGCC
NM_013291.2       ATGCTGCAGAACGCGCTGACCACCATGCTGCCACACCACGCCGGCCTCAACCCCCGCGCC
                  ************************************************************

HsCD00042068      TTCCGGATGCTGCACGTGGACCGCCGCACCCTCCAGAATGCCGTGCGCAACGTGCTGGAT
NM_013291.2       TTCCGGATGCTGCACGTGGACCGCCGCACCCTCCAGAATGCCGTGCGCAACGTGCTGGAT
                  ************************************************************

HsCD00042068      GGGGAGCTGCTCAACCGCTACCTGTACCTGAGCACCATGGAGCGCAGCGAGCTAGCCAAG
NM_013291.2       GGGGAGCTGCTCAACCGCTACCTGTACCTGAGCACCATGGAGCGCAGCGAGCTAGCCAAG
                  ************************************************************

HsCD00042068      AAGATCGGCACCACACCAGACATAATCCTGGACGACTTGCTGGAGACGGACCGCGTCACC
NM_013291.2       AAGATCGGCACCACACCAGACATAATCCTGGACGACTTGCTGGAGACGGACCGCGTCACC
                  ************************************************************

HsCD00042068      GCCCACTTCTTG
NM_013291.2       GCCCACTTCTAG
                  **********:*

Pathways

Reactome : Cleavage of Growing Transcript in the Termination Region
Reactome : Gene Expression
Reactome : Post-Elongation Processing of Intron-Containing pre-mRNA
Reactome : Post-Elongation Processing of Intronless pre-mRNA
Reactome : Post-Elongation Processing of the Transcript
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : Processing of Capped Intronless Pre-mRNA
Reactome : Processing of Intronless Pre-mRNAs
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Termination
Reactome : Transcription
Reactome : Transport of Mature Transcript to Cytoplasm
Reactome : Transport of Mature mRNA Derived from an Intronless Transcript
Reactome : Transport of Mature mRNAs Derived from Intronless Transcripts
Reactome : mRNA 3'-end processing
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
WikiPathway : mRNA processing

Protein

UniProt : Q10570
HPRD : 05823

Clone

Cloning Information : 193594
HIP Master Clone ID : 168305
Original Clone ID : FLH193594.01L

Organism


TAX_ID : 9606
Species Specific ID: 29894

Genome

Chromosome : 8
Map Location : 8q24.23
Ensembl : ENSG00000071894

Reagents

Labome : CPSF1-antibody