DNASU Plasmid Repository • 480.965.2857 | Email

PTPRO (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTPRO
Gene Name:  protein tyrosine phosphatase, receptor type, O
Sequence             
Original Clone ID: 8635a3BCt1p1
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  FUSION
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: PMID: 18058037
Title: Structural genomics of protein phosphatases
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00423639

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 810nts         Open reading frame : 51 to 860
Reference Sequence Alignment

ATGACTTTGATGCCTATATTAAGGATATGGCCAAAGACTCTGACTATAAATTTTCTCTTC
AGTTTGAGGAGTTGAAATTGATTGGACTGGATATCCCACACTTTGCTGCAGATCTGCCAC
TGAATCGATGTAAAAACCGTTACACAAACATCCTACCATATGACTTCAGCCGTGTGAGAT
TAGTCTCCATGAATGAAGAGGAAGGTGCAGACTACATCAATGCCAACTATATTCCTGGAT
ACAACTCACCCCAGGAGTATATTGCCACCCAGGGGCCACTGCCTGAAACCAGAAATGACT
TCTGGAAGATGGTCCTGCAACAAAAGTCTCAGATTATTGTCATGCTCACTCAGTGTAATG
AGAAAAGGAGGGTGAAATGTGACCATTACTGGCCATTCACGGAAGAACCTATAGCCTATG
GAGACATCACTGTGGAGATGATTTCAGAGGAAGAGCAGGACGACTGGGCCTGTAGACACT
TCCGGATCAACTATGCTGACGAGATGCAGGATGTGATGCATTTTAACTACACTGCATGGC
CTGATCATGGTGTGCCCACAGCAAATGCTGCAGAAAGTATCCTGCAGTTTGTACACATGG
TCCGACAGCAAGCTACCAAGAGCAAAGGTCCCATGATCATTCACTGCAGTGCTGGCGTGG
GACGGACAGGAACATTCATTGCCCTGGACAGGCTCTTGCAGCACATTCGGGATCATGAGT
TTGTTGACATCTTAGGGCTGGTGTCAGAAATGAGGTCATACCGGATGTCTATGGTACAGA
CAGAGGAGCAGTACATTTTTATCCATCAGTGTGTGCAACTGATGTGGATGAAGAAGAAGG
AAGGGCATCATCACCATCAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-8635a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTPRO
Symbol Nomenclature : PTPRO
SYNONYM : GLEPP1; NPHS6; PTP-OC; PTP-U2; PTPROT; PTPU2; R-PTP-O
Designation : PTP phi|PTPase U2|glomerular epithelial protein 1|osteoclastic transmembrane protein-tyrosine phosphatase|phosphotyrosine phosphatase U2|protein tyrosine phosphatase PTP-U2|receptor-type tyrosine-protein phosphatase O
Full Nomenclature : protein tyrosine phosphatase, receptor type, O
GENEID : 5800
GI : 13677214
GenBank Accession : NM_030667
HGNC : 9678
MIM : 600579
Vega : OTTHUMG00000168786
Target GenBank: 454477

 

Reference Sequence Alignment

  

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       ATGGGGCACCTGCCCACGGGGATACACGGCGCCCGCCGCCTCCTGCCTCTGCTCTGGCTC
NM_002848.3       ATGGGGCACCTGCCCACGGGGATACACGGCGCCCGCCGCCTCCTGCCTCTGCTCTGGCTC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TTTGTGCTGTTCAAGAATGCTACAGCTTTCCATGTAACTGTCCAAGATGATAATAACATC
NM_002848.3       TTTGTGCTGTTCAAGAATGCTACAGCTTTCCATGTAACTGTCCAAGATGATAATAACATC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       GTTGTCTCATTAGAAGCTTCAGACGTCATCAGTCCAGCATCTGTGTATGTTGTGAAGATA
NM_002848.3       GTTGTCTCATTAGAAGCTTCAGACGTCATCAGTCCAGCATCTGTGTATGTTGTGAAGATA
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       ACTGGTGAATCCAAAAATTATTTCTTCGAATTTGAGGAATTCAACAGCACTTTGCCTCCT
NM_002848.3       ACTGGTGAATCCAAAAATTATTTCTTCGAATTTGAGGAATTCAACAGCACTTTGCCTCCT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       CCTGTTATTTTCAAGGCCAGTTATCATGGCCTTTATTATATAATCACTCTGGTAGTGGTA
NM_002848.3       CCTGTTATTTTCAAGGCCAGTTATCATGGCCTTTATTATATAATCACTCTGGTAGTGGTA
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       AATGGAAATGTGGTGACCAAGCCATCCAGATCAATCACTGTGTTAACAAAACCTCTACCT
NM_002848.3       AATGGAAATGTGGTGACCAAGCCATCCAGATCAATCACTGTGTTAACAAAACCTCTACCT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       GTAACCAGTGTTTCCATATATGACTATAAACCTTCTCCTGAAACAGGAGTCCTGTTTGAA
NM_002848.3       GTAACCAGTGTTTCCATATATGACTATAAACCTTCTCCTGAAACAGGAGTCCTGTTTGAA
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       ATACATTATCCAGAAAAATATAACGTTTTCACAAGAGTGAACATTAGCTACTGGGAAGGT
NM_002848.3       ATACATTATCCAGAAAAATATAACGTTTTCACAAGAGTGAACATTAGCTACTGGGAAGGT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       AAAGACTTCCGGACAATGCTATATAAAGATTTCTTTAAGGGAAAAACAGTATTTAATCAC
NM_002848.3       AAAGACTTCCGGACAATGCTATATAAAGATTTCTTTAAGGGAAAAACAGTATTTAATCAC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TGGCTGCCAGGAATGTGTTATAGTAATATCACCTTTCAGCTGGTATCTGAGGCAACTTTT
NM_002848.3       TGGCTGCCAGGAATGTGTTATAGTAATATCACCTTTCAGCTGGTATCTGAGGCAACTTTT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       AATAAAAGTACCCTTGTTGAGTACAGTGGTGTCAGTCACGAACCCAAACAGCACAGAACT
NM_002848.3       AATAAAAGTACCCTTGTTGAGTACAGTGGTGTCAGTCACGAACCCAAACAGCACAGAACT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       GCCCCTTATCCACCTCAAAATATTTCCGTTCGTATCGTAAACTTGAACAAAAACAACTGG
NM_002848.3       GCCCCTTATCCACCTCAAAATATTTCCGTTCGTATCGTAAACTTGAACAAAAACAACTGG
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       GAAGAACAGAGTGGCAATTTCCCAGAAGAATCCTTCATGAGATCACAAGATACAATAGGA
NM_002848.3       GAAGAACAGAGTGGCAATTTCCCAGAAGAATCCTTCATGAGATCACAAGATACAATAGGA
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       AAAGAAAAACTCTTCCATTTTACAGAAGAAACCCCTGAAATTCCCTCGGGCAACATTTCT
NM_002848.3       AAAGAAAAACTCTTCCATTTTACAGAAGAAACCCCTGAAATTCCCTCGGGCAACATTTCT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TCCGGTTGGCCTGATTTTAATAGCAGTGACTATGAAACTACGTCTCAGCCATATTGGTGG
NM_002848.3       TCCGGTTGGCCTGATTTTAATAGCAGTGACTATGAAACTACGTCTCAGCCATATTGGTGG
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       GACAGTGCATCTGCAGCTCCTGAAAGTGAAGATGAATTTGTCAGCGTACTTCCCATGGAA
NM_002848.3       GACAGTGCATCTGCAGCTCCTGAAAGTGAAGATGAATTTGTCAGCGTACTTCCCATGGAA
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TACGAAAATAACAGTACACTCAGTGAGACAGAGAAGTCAACATCAGGCTCTTTCTCCTTT
NM_002848.3       TACGAAAATAACAGTACACTCAGTGAGACAGAGAAGTCAACATCAGGCTCTTTCTCCTTT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TTCCCTGTGCAAATGATATTGACCTGGTTACCACCCAAACCACCCACTGCTTTTGATGGG
NM_002848.3       TTCCCTGTGCAAATGATATTGACCTGGTTACCACCCAAACCACCCACTGCTTTTGATGGG
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TTCCATATCCATATTGAACGAGAAGAGAACTTTACTGAATATTTGATGGTGGATGAAGAA
NM_002848.3       TTCCATATCCATATTGAACGAGAAGAGAACTTTACTGAATATTTGATGGTGGATGAAGAA
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       GCACATGAATTTGTTGCAGAACTGAAGGAACCTGGGAAATATAAGTTATCTGTGACAACC
NM_002848.3       GCACATGAATTTGTTGCAGAACTGAAGGAACCTGGGAAATATAAGTTATCTGTGACAACC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TTTAGTTCCTCAGGATCTTGTGAAACTCGAAAAAGTCAGTCAGCAAAATCACTCAGCTTT
NM_002848.3       TTTAGTTCCTCAGGATCTTGTGAAACTCGAAAAAGTCAGTCAGCAAAATCACTCAGCTTT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TATATCAGTCCTTCAGGAGAGTGGATTGAAGAACTGACCGAGAAGCCGCAGCACGTGAGT
NM_002848.3       TATATCAGTCCTTCAGGAGAGTGGATTGAAGAACTGACCGAGAAGCCGCAGCACGTGAGT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       GTCCACGTTTTAAGCTCAACCACTGCCTTGATGTCCTGGACATCTTCCCAAGAGAACTAC
NM_002848.3       GTCCACGTTTTAAGCTCAACCACTGCCTTGATGTCCTGGACATCTTCCCAAGAGAACTAC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       AACAGCACCATTGTGTCTGTGGTGTCGCTGACCTGCCAGAAACAAAAGGAGAGCCAGAGG
NM_002848.3       AACAGCACCATTGTGTCTGTGGTGTCGCTGACCTGCCAGAAACAAAAGGAGAGCCAGAGG
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       CTTGAAAAGCAGTACTGCACTCAGGTGAACTCAAGCAAACCTATTATTGAAAATCTGGTT
NM_002848.3       CTTGAAAAGCAGTACTGCACTCAGGTGAACTCAAGCAAACCTATTATTGAAAATCTGGTT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       CCTGGTGCCCAGTACCAGGTTGTAATATACCTAAGGAAAGGCCCTTTGATTGGACCACCT
NM_002848.3       CCTGGTGCCCAGTACCAGGTTGTAATATACCTAAGGAAAGGCCCTTTGATTGGACCACCT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TCAGATCCTGTGACATTTGCTATTGTTCCCACAGGAATAAAGGATTTAATGCTCTATCCT
NM_002848.3       TCAGATCCTGTGACATTTGCTATTGTTCCCACAGGAATAAAGGATTTAATGCTCTATCCT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TTGGGTCCTACGGCCGTGGTTCTGAGCTGGACCAGACCTTATTTAGGCGTGTTCAGAAAA
NM_002848.3       TTGGGTCCTACGGCCGTGGTTCTGAGCTGGACCAGACCTTATTTAGGCGTGTTCAGAAAA
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TACGTGGTTGAAATGTTTTATTTCAACCCTGCTACAATGACATCAGAGTGGACCACCTAC
NM_002848.3       TACGTGGTTGAAATGTTTTATTTCAACCCTGCTACAATGACATCAGAGTGGACCACCTAC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TATGAAATAGCAGCAACTGTTTCCTTAACTGCATCCGTGAGAATAGCTAATCTGCTGCCA
NM_002848.3       TATGAAATAGCAGCAACTGTTTCCTTAACTGCATCCGTGAGAATAGCTAATCTGCTGCCA
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       GCATGGTACTACAACTTCCGGGTTACCATGGTGACGTGGGGAGATCCAGAATTGAGCTGC
NM_002848.3       GCATGGTACTACAACTTCCGGGTTACCATGGTGACGTGGGGAGATCCAGAATTGAGCTGC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TGTGACAGCTCTACCATCAGCTTCATAACAGCCCCAGTGGCTCCGGAAATCACTTCTGTG
NM_002848.3       TGTGACAGCTCTACCATCAGCTTCATAACAGCCCCAGTGGCTCCGGAAATCACTTCTGTG
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       GAATATTTCAACAGTCTGTTATATATCAGTTGGACATATGGGGATGATACAACGGACTTG
NM_002848.3       GAATATTTCAACAGTCTGTTATATATCAGTTGGACATATGGGGATGATACAACGGACTTG
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TCCCATTCTAGAATGCTTCACTGGATGGTGGTTGCAGAAGGAAAAAAGAAAATTAAAAAG
NM_002848.3       TCCCATTCTAGAATGCTTCACTGGATGGTGGTTGCAGAAGGAAAAAAGAAAATTAAAAAG
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       AGTGTAACACGCAATGTCATGACTGCAATTCTCAGCTTGCCTCCAGGCGACATCTATAAC
NM_002848.3       AGTGTAACACGCAATGTCATGACTGCAATTCTCAGCTTGCCTCCAGGCGACATCTATAAC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       CTCTCAGTAACTGCTTGTACTGAAAGAGGAAGTAATACCTCCATGCTCCGCCTTGTCAAG
NM_002848.3       CTCTCAGTAACTGCTTGTACTGAAAGAGGAAGTAATACCTCCATGCTCCGCCTTGTCAAG
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       CTAGAACCAGCTCCACCCAAATCACTCTTCGCAGTGAACAAAACCCAGACTTCAGTGACT
NM_002848.3       CTAGAACCAGCTCCACCCAAATCACTCTTCGCAGTGAACAAAACCCAGACTTCAGTGACT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TTGCTGTGGGTGGAAGAGGGAGTAGCTGATTTCTTTGAAGTTTTCTGTCAACAAGTTGGC
NM_002848.3       TTGCTGTGGGTGGAAGAGGGAGTAGCTGATTTCTTTGAAGTTTTCTGTCAACAAGTTGGC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TCCAGTCAGAAAACCAAACTTCAGGAACCAGTTGCTGTTTCTTCCCATGTCGTGACCATC
NM_002848.3       TCCAGTCAGAAAACCAAACTTCAGGAACCAGTTGCTGTTTCTTCCCATGTCGTGACCATC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       ------------------------------------------------------------
NM_030668.2       ------------------------------------------------------------
NM_030671.2       ------------------------------------------------------------
NM_030667.2       TCCAGCCTTCTTCCTGCCACTGCCTACAATTGTAGTGTCACCAGCTTTAGCCATGACAGC
NM_002848.3       TCCAGCCTTCTTCCTGCCACTGCCTACAATTGTAGTGTCACCAGCTTTAGCCATGACAGC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ---------------------------------ATGGTTACAGAGATGAATCCCAATGTG
NM_030669.2       ---------------------------------ATGGTTACAGAGATGAATCCCAATGTG
NM_030668.2       ---------------------------------ATGGTTACAGAGATGAATCCCAATGTG
NM_030671.2       ---------------------------------ATGGTTACAGAGATGAATCCCAATGTG
NM_030667.2       CCCAGTGTCCCTACGTTCATAGCCGTCTCAACAATGGTTACAGAGATGAATCCCAATGTG
NM_002848.3       CCCAGTGTCCCTACGTTCATAGCCGTCTCAACAATGGTTACAGAGATGAATCCCAATGTG
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       GTAGTGATCTCCGTGCTGGCCATCCTTAGCACACTTTTAATTGGACTGTTGCTTGTTACC
NM_030669.2       GTAGTGATCTCCGTGCTGGCCATCCTTAGCACACTTTTAATTGGACTGTTGCTTGTTACC
NM_030668.2       GTAGTGATCTCCGTGCTGGCCATCCTTAGCACACTTTTAATTGGACTGTTGCTTGTTACC
NM_030671.2       GTAGTGATCTCCGTGCTGGCCATCCTTAGCACACTTTTAATTGGACTGTTGCTTGTTACC
NM_030667.2       GTAGTGATCTCCGTGCTGGCCATCCTTAGCACACTTTTAATTGGACTGTTGCTTGTTACC
NM_002848.3       GTAGTGATCTCCGTGCTGGCCATCCTTAGCACACTTTTAATTGGACTGTTGCTTGTTACC
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       CTCATTATTCTTAGGAAAAAGCATCTGCAGATGGCTAGGGAGTGTGGAGCTGGTACATTT
NM_030669.2       CTCATTATTCTTAGGAAAAAGCATCTGCAGATGGCTAGGGAGTGTGGAGCTGGTACATTT
NM_030668.2       CTCATTATTCTTAGGAAAAAGCATCTGCAGATGGCTAGGGAGTGTGGAGCTGGTACATTT
NM_030671.2       CTCATTATTCTTAGGAAAAAGCATCTGCAGATGGCTAGGGAGTGTGGAGCTGGTACATTT
NM_030667.2       CTCATTATTCTTAGGAAAAAGCATCTGCAGATGGCTAGGGAGTGTGGAGCTGGTACATTT
NM_002848.3       CTCATTATTCTTAGGAAAAAGCATCTGCAGATGGCTAGGGAGTGTGGAGCTGGTACATTT
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       GTCAATTTTGCATCCTTAGAGAGGGATGGAAAGCTTCCATACAACTG-------------
NM_030669.2       GTCAATTTTGCATCCTTAGAGAGGGATGGAAAGCTTCCATACAACTGGCGTAGGAGTATA
NM_030668.2       GTCAATTTTGCATCCTTAGAGAGGGATGGAAAGCTTCCATACAACTG-------------
NM_030671.2       GTCAATTTTGCATCCTTAGAGAGGGATGGAAAGCTTCCATACAACTGGCGTAGGAGTATA
NM_030667.2       GTCAATTTTGCATCCTTAGAGAGGGATGGAAAGCTTCCATACAACTGGCGTAGGAGTATA
NM_002848.3       GTCAATTTTGCATCCTTAGAGAGGGATGGAAAGCTTCCATACAACTG-------------
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       ------------------------------------------------------------
NM_030669.2       TTTGCTTTCTTAACCCTGCTACCCTCATGTCTTTGGACTGATTATCTTTTGGCATTTTAT
NM_030668.2       ------------------------------------------------------------
NM_030671.2       TTTGCTTTCTTAACCCTGCTACCCTCATGTCTTTGGACTGATTATCTTTTGGCATTTTAT
NM_030667.2       TTTGCTTTCTTAACCCTGCTACCCTCATGTCTTTGGACTGATTATCTTTTGGCATTTTAT
NM_002848.3       ------------------------------------------------------------
                                                                              

HsCD00423639      ------------------------------------------------------------
NM_030670.2       -----------GAGTAAAAATGGTTTAAAGAAGAGGAAACTGACAAACCCGGTTCAACTG
NM_030669.2       ATTAATCCTTGGAGTAAAAATGGTTTAAAGAAGAGGAAACTGACAAACCCGGTTCAACTG
NM_030668.2       -----------GAGTAAAAATGGTTTAAAGAAGAGGAAACTGACAAACCCGGTTCAACTG
NM_030671.2       ATTAATCCTTGGAGTAAAAATGGTTTAAAGAAGAGGAAACTGACAAACCCGGTTCAACTG
NM_030667.2       ATTAATCCTTGGAGTAAAAATGGTTTAAAGAAGAGGAAACTGACAAACCCGGTTCAACTG
NM_002848.3       -----------GAGTAAAAATGGTTTAAAGAAGAGGAAACTGACAAACCCGGTTCAACTG
                                                                              

HsCD00423639      -ATGACTTTGATGCCTATATTAAGGATATGGCCAAAGACTCTGACTATAAATTTTCTCTT
NM_030670.2       GATGACTTTGATGCCTATATTAAGGATATGGCCAAAGACTCTGACTATAAATTTTCTCTT
NM_030669.2       GATGACTTTGATGCCTATATTAAGGATATGGCCAAAGACTCTGACTATAAATTTTCTCTT
NM_030668.2       GATGACTTTGATGCCTATATTAAGGATATGGCCAAAGACTCTGACTATAAATTTTCTCTT
NM_030671.2       GATGACTTTGATGCCTATATTAAGGATATGGCCAAAGACTCTGACTATAAATTTTCTCTT
NM_030667.2       GATGACTTTGATGCCTATATTAAGGATATGGCCAAAGACTCTGACTATAAATTTTCTCTT
NM_002848.3       GATGACTTTGATGCCTATATTAAGGATATGGCCAAAGACTCTGACTATAAATTTTCTCTT
                   ***********************************************************

HsCD00423639      CAGTTTGAGGAGTTGAAATTGATTGGACTGGATATCCCACACTTTGCTGCAGATCTGCCA
NM_030670.2       CAGTTTGAGGAGTTGAAATTGATTGGACTGGATATCCCACACTTTGCTGCAGATCTTCCA
NM_030669.2       CAGTTTGAGGAGTTGAAATTGATTGGACTGGATATCCCACACTTTGCTGCAGATCTTCCA
NM_030668.2       CAGTTTGAGGAGTTGAAATTGATTGGACTGGATATCCCACACTTTGCTGCAGATCTTCCA
NM_030671.2       CAGTTTGAGGAGTTGAAATTGATTGGACTGGATATCCCACACTTTGCTGCAGATCTTCCA
NM_030667.2       CAGTTTGAGGAGTTGAAATTGATTGGACTGGATATCCCACACTTTGCTGCAGATCTTCCA
NM_002848.3       CAGTTTGAGGAGTTGAAATTGATTGGACTGGATATCCCACACTTTGCTGCAGATCTTCCA
                  ******************************************************** ***

HsCD00423639      CTGAATCGATGTAAAAACCGTTACACAAACATCCTACCATATGACTTCAGCCGTGTGAGA
NM_030670.2       CTGAATCGATGTAAAAACCGTTACACAAACATCCTACCATATGACTTCAGCCGTGTGAGA
NM_030669.2       CTGAATCGATGTAAAAACCGTTACACAAACATCCTACCATATGACTTCAGCCGTGTGAGA
NM_030668.2       CTGAATCGATGTAAAAACCGTTACACAAACATCCTACCATATGACTTCAGCCGTGTGAGA
NM_030671.2       CTGAATCGATGTAAAAACCGTTACACAAACATCCTACCATATGACTTCAGCCGTGTGAGA
NM_030667.2       CTGAATCGATGTAAAAACCGTTACACAAACATCCTACCATATGACTTCAGCCGTGTGAGA
NM_002848.3       CTGAATCGATGTAAAAACCGTTACACAAACATCCTACCATATGACTTCAGCCGTGTGAGA
                  ************************************************************

HsCD00423639      TTAGTCTCCATGAATGAAGAGGAAGGTGCAGACTACATCAATGCCAACTATATTCCTGGA
NM_030670.2       TTAGTCTCCATGAATGAAGAGGAAGGTGCAGACTACATCAATGCCAACTATATTCCTGGA
NM_030669.2       TTAGTCTCCATGAATGAAGAGGAAGGTGCAGACTACATCAATGCCAACTATATTCCTGGA
NM_030668.2       TTAGTCTCCATGAATGAAGAGGAAGGTGCAGACTACATCAATGCCAACTATATTCCTGGA
NM_030671.2       TTAGTCTCCATGAATGAAGAGGAAGGTGCAGACTACATCAATGCCAACTATATTCCTGGA
NM_030667.2       TTAGTCTCCATGAATGAAGAGGAAGGTGCAGACTACATCAATGCCAACTATATTCCTGGA
NM_002848.3       TTAGTCTCCATGAATGAAGAGGAAGGTGCAGACTACATCAATGCCAACTATATTCCTGGA
                  ************************************************************

HsCD00423639      TACAACTCACCCCAGGAGTATATTGCCACCCAGGGGCCACTGCCTGAAACCAGAAATGAC
NM_030670.2       TACAACTCACCCCAGGAGTATATTGCCACCCAGGGGCCACTGCCTGAAACCAGAAATGAC
NM_030669.2       TACAACTCACCCCAGGAGTATATTGCCACCCAGGGGCCACTGCCTGAAACCAGAAATGAC
NM_030668.2       TACAACTCACCCCAGGAGTATATTGCCACCCAGGGGCCACTGCCTGAAACCAGAAATGAC
NM_030671.2       TACAACTCACCCCAGGAGTATATTGCCACCCAGGGGCCACTGCCTGAAACCAGAAATGAC
NM_030667.2       TACAACTCACCCCAGGAGTATATTGCCACCCAGGGGCCACTGCCTGAAACCAGAAATGAC
NM_002848.3       TACAACTCACCCCAGGAGTATATTGCCACCCAGGGGCCACTGCCTGAAACCAGAAATGAC
                  ************************************************************

HsCD00423639      TTCTGGAAGATGGTCCTGCAACAAAAGTCTCAGATTATTGTCATGCTCACTCAGTGTAAT
NM_030670.2       TTCTGGAAGATGGTCCTGCAACAAAAGTCTCAGATTATTGTCATGCTCACTCAGTGTAAT
NM_030669.2       TTCTGGAAGATGGTCCTGCAACAAAAGTCTCAGATTATTGTCATGCTCACTCAGTGTAAT
NM_030668.2       TTCTGGAAGATGGTCCTGCAACAAAAGTCTCAGATTATTGTCATGCTCACTCAGTGTAAT
NM_030671.2       TTCTGGAAGATGGTCCTGCAACAAAAGTCTCAGATTATTGTCATGCTCACTCAGTGTAAT
NM_030667.2       TTCTGGAAGATGGTCCTGCAACAAAAGTCTCAGATTATTGTCATGCTCACTCAGTGTAAT
NM_002848.3       TTCTGGAAGATGGTCCTGCAACAAAAGTCTCAGATTATTGTCATGCTCACTCAGTGTAAT
                  ************************************************************

HsCD00423639      GAGAAAAGGAGGGTGAAATGTGACCATTACTGGCCATTCACGGAAGAACCTATAGCCTAT
NM_030670.2       GAGAAAAGGAGGGTGAAATGTGACCATTACTGGCCATTCACGGAAGAACCTATAGCCTAT
NM_030669.2       GAGAAAAGGAGGGTGAAATGTGACCATTACTGGCCATTCACGGAAGAACCTATAGCCTAT
NM_030668.2       GAGAAAAGGAGGGTGAAATGTGACCATTACTGGCCATTCACGGAAGAACCTATAGCCTAT
NM_030671.2       GAGAAAAGGAGGGTGAAATGTGACCATTACTGGCCATTCACGGAAGAACCTATAGCCTAT
NM_030667.2       GAGAAAAGGAGGGTGAAATGTGACCATTACTGGCCATTCACGGAAGAACCTATAGCCTAT
NM_002848.3       GAGAAAAGGAGGGTGAAATGTGACCATTACTGGCCATTCACGGAAGAACCTATAGCCTAT
                  ************************************************************

HsCD00423639      GGAGACATCACTGTGGAGATGATTTCAGAGGAAGAGCAGGACGACTGGGCCTGTAGACAC
NM_030670.2       GGAGACATCACTGTGGAGATGATTTCAGAGGAAGAGCAGGACGACTGGGCCTGTAGACAC
NM_030669.2       GGAGACATCACTGTGGAGATGATTTCAGAGGAAGAGCAGGACGACTGGGCCTGTAGACAC
NM_030668.2       GGAGACATCACTGTGGAGATGATTTCAGAGGAAGAGCAGGACGACTGGGCCTGTAGACAC
NM_030671.2       GGAGACATCACTGTGGAGATGATTTCAGAGGAAGAGCAGGACGACTGGGCCTGTAGACAC
NM_030667.2       GGAGACATCACTGTGGAGATGATTTCAGAGGAAGAGCAGGACGACTGGGCCTGTAGACAC
NM_002848.3       GGAGACATCACTGTGGAGATGATTTCAGAGGAAGAGCAGGACGACTGGGCCTGTAGACAC
                  ************************************************************

HsCD00423639      TTCCGGATCAACTATGCTGACGAGATGCAGGATGTGATGCATTTTAACTACACTGCATGG
NM_030670.2       TTCCGGATCAACTATGCTGACGAGATGCAGGATGTGATGCATTTTAACTACACTGCATGG
NM_030669.2       TTCCGGATCAACTATGCTGACGAGATGCAGGATGTGATGCATTTTAACTACACTGCATGG
NM_030668.2       TTCCGGATCAACTATGCTGACGAGATGCAGGATGTGATGCATTTTAACTACACTGCATGG
NM_030671.2       TTCCGGATCAACTATGCTGACGAGATGCAGGATGTGATGCATTTTAACTACACTGCATGG
NM_030667.2       TTCCGGATCAACTATGCTGACGAGATGCAGGATGTGATGCATTTTAACTACACTGCATGG
NM_002848.3       TTCCGGATCAACTATGCTGACGAGATGCAGGATGTGATGCATTTTAACTACACTGCATGG
                  ************************************************************

HsCD00423639      CCTGATCATGGTGTGCCCACAGCAAATGCTGCAGAAAGTATCCTGCAGTTTGTACACATG
NM_030670.2       CCTGATCATGGTGTGCCCACAGCAAATGCTGCAGAAAGTATCCTGCAGTTTGTACACATG
NM_030669.2       CCTGATCATGGTGTGCCCACAGCAAATGCTGCAGAAAGTATCCTGCAGTTTGTACACATG
NM_030668.2       CCTGATCATGGTGTGCCCACAGCAAATGCTGCAGAAAGTATCCTGCAGTTTGTACACATG
NM_030671.2       CCTGATCATGGTGTGCCCACAGCAAATGCTGCAGAAAGTATCCTGCAGTTTGTACACATG
NM_030667.2       CCTGATCATGGTGTGCCCACAGCAAATGCTGCAGAAAGTATCCTGCAGTTTGTACACATG
NM_002848.3       CCTGATCATGGTGTGCCCACAGCAAATGCTGCAGAAAGTATCCTGCAGTTTGTACACATG
                  ************************************************************

HsCD00423639      GTCCGACAGCAAGCTACCAAGAGCAAAGGTCCCATGATCATTCACTGCAGTGCTGGCGTG
NM_030670.2       GTCCGACAGCAAGCTACCAAGAGCAAAGGTCCCATGATCATTCACTGCAGTGCTGGCGTG
NM_030669.2       GTCCGACAGCAAGCTACCAAGAGCAAAGGTCCCATGATCATTCACTGCAGTGCTGGCGTG
NM_030668.2       GTCCGACAGCAAGCTACCAAGAGCAAAGGTCCCATGATCATTCACTGCAGTGCTGGCGTG
NM_030671.2       GTCCGACAGCAAGCTACCAAGAGCAAAGGTCCCATGATCATTCACTGCAGTGCTGGCGTG
NM_030667.2       GTCCGACAGCAAGCTACCAAGAGCAAAGGTCCCATGATCATTCACTGCAGTGCTGGCGTG
NM_002848.3       GTCCGACAGCAAGCTACCAAGAGCAAAGGTCCCATGATCATTCACTGCAGTGCTGGCGTG
                  ************************************************************

HsCD00423639      GGACGGACAGGAACATTCATTGCCCTGGACAGGCTCTTGCAGCACATTCGGGATCATGAG
NM_030670.2       GGACGGACAGGAACATTCATTGCCCTGGACAGGCTCTTGCAGCACATTCGGGATCATGAG
NM_030669.2       GGACGGACAGGAACATTCATTGCCCTGGACAGGCTCTTGCAGCACATTCGGGATCATGAG
NM_030668.2       GGACGGACAGGAACATTCATTGCCCTGGACAGGCTCTTGCAGCACATTCGGGATCATGAG
NM_030671.2       GGACGGACAGGAACATTCATTGCCCTGGACAGGCTCTTGCAGCACATTCGGGATCATGAG
NM_030667.2       GGACGGACAGGAACATTCATTGCCCTGGACAGGCTCTTGCAGCACATTCGGGATCATGAG
NM_002848.3       GGACGGACAGGAACATTCATTGCCCTGGACAGGCTCTTGCAGCACATTCGGGATCATGAG
                  ************************************************************

HsCD00423639      TTTGTTGACATCTTAGGGCTGGTGTCAGAAATGAGGTCATACCGGATGTCTATGGTACAG
NM_030670.2       TTTGTTGACATCTTAGGGCTGGTGTCAGAAATGAGGTCATACCGGATGTCTATGGTACAG
NM_030669.2       TTTGTTGACATCTTAGGGCTGGTGTCAGAAATGAGGTCATACCGGATGTCTATGGTACAG
NM_030668.2       TTTGTTGACATCTTAGGGCTGGTGTCAGAAATGAGGTCATACCGGATGTCTATGGTACAG
NM_030671.2       TTTGTTGACATCTTAGGGCTGGTGTCAGAAATGAGGTCATACCGGATGTCTATGGTACAG
NM_030667.2       TTTGTTGACATCTTAGGGCTGGTGTCAGAAATGAGGTCATACCGGATGTCTATGGTACAG
NM_002848.3       TTTGTTGACATCTTAGGGCTGGTGTCAGAAATGAGGTCATACCGGATGTCTATGGTACAG
                  ************************************************************

HsCD00423639      ACAGAGGAGCAGTACATTTTTATCCATCAGTGTGTGCAACTGATGTGGATGAAGAAGAAG
NM_030670.2       ACAGAGGAGCAGTACATTTTTATCCATCAGTGTGTGCAACTGATGTGGATGAAGAAGAAG
NM_030669.2       ACAGAGGAGCAGTACATTTTTATCCATCAGTGTGTGCAACTGATGTGGATGAAGAAGAAG
NM_030668.2       ACAGAGGAGCAGTACATTTTTATCCATCAGTGTGTGCAACTGATGTGGATGAAGAAGAAG
NM_030671.2       ACAGAGGAGCAGTACATTTTTATCCATCAGTGTGTGCAACTGATGTGGATGAAGAAGAAG
NM_030667.2       ACAGAGGAGCAGTACATTTTTATCCATCAGTGTGTGCAACTGATGTGGATGAAGAAGAAG
NM_002848.3       ACAGAGGAGCAGTACATTTTTATCCATCAGTGTGTGCAACTGATGTGGATGAAGAAGAAG
                  ************************************************************

HsCD00423639      GAAGGGCATCATCACCATCAC------------------------------
NM_030670.2       CAGCAGTTCTGCATCAGTGATGTCATATACGAGAATGTTAGCAAGTCCTAG
NM_030669.2       CAGCAGTTCTGCATCAGTGATGTCATATACGAGAATGTTAGCAAGTCCTAG
NM_030668.2       CAGCAGTTCTGCATCAGTGATGTCATATACGAGAATGTTAGCAAGTCCTAG
NM_030671.2       CAGCAGTTCTGCATCAGTGATGTCATATACGAGAATGTTAGCAAGTCCTAG
NM_030667.2       CAGCAGTTCTGCATCAGTGATGTCATATACGAGAATGTTAGCAAGTCCTAG
NM_002848.3       CAGCAGTTCTGCATCAGTGATGTCATATACGAGAATGTTAGCAAGTCCTAG
                   *. .* :  . .:*..* *                               

Pathways

NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)

Protein

PDB - Structural Annotation : 2G59
SMART domain : PTPc : Protein tyrosine phosphatase, catalytic domain
SMART domain : PTPc_motif : Protein tyrosine phosphatase, catalytic domain motif
Structural Annotation Wiki : TOPSAN
HPRD : 02784
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 494273
HIP Master Clone ID : 407953
Original Clone ID : 8635a3BCt1p1

Experimental

Structural Biology Knowledgebase : SBKB (2G59)
TargetTrack - Experimental data : NYSGXRC-8635a

Organism


TAX_ID : 9606
Species Specific ID: 5800

Genome

Chromosome : 12
Map Location : 12p13.3-p13.2|12p13-p12
Ensembl : ENSG00000151490

Reagents

Labome : phosphotyrosine-antibody