DNASU Plasmid Repository • 480.965.5697 | Email

Prkab2 (Mus musculus) in pVP33K (His and MBP-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  Prkab2
Gene Name:  protein kinase, AMP-activated, beta 2 non-catalytic subunit
Sequence             
Original Clone ID: 1683.1.68_GO.79335
Keyword: full-length cds
Species: Mus musculus
Type: cDNA
Vector Name: pVP33K               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
MmCD00423853

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 822nts        
Open reading frame : 51 to 872

TGTTCCAGGGGCCCTGTTGCCCAGGTTGCTGTGAAAACCTGTACTTCCAGGCGATCGCCG
GAAACACTACCAGCGAGCGGGTGTCCGGGGAGCGCCACGGAGCCAAAGCTGCTCGAGCTG
AGGGCGGCGGCCATGGCCCGGGAAAGGAGCACAAGATCATGGTGGGGAGCACGGACGACC
CCAGCGTCTTCAGCCTGCCCGACTCCAAGCTCCCCGGGGACAAAGAGTTTGTACCCTGGC
AGCAGGATTTGGATGATTCTGTGAAGCCCGCCCAGCAGGCCCGGCCCACCGTTATCCGCT
GGTCTGAAGGAGGCAAGGAGGTCTTCATCTCTGGGTCCTTCAACAATTGGAGCACCAAGA
TCCCTCTGATAAAGAGTCATAATGACTTCGTTGCCATCCTGGATCTTCCAGAGGGAGAGC
ATCAGTACAAGTTCTTTGTGGACGGACAGTGGGTTCATGATCCGTCAGAGCCTGTGGTTA
CCAGTCAGCTTGGAACAATTAATAACTTGATCCACGTCAAGAAATCTGATTTTGAAGTAT
TTGACGCTTTAAAGTTAGACTCTATGGAAAGCTCGGAGACGTCATGTCGAGACCTGTCCA
GCTCACCCCCTGGGCCTTACGGTCAAGAAATGTATGTGTTTCGATCTGAGGAGAGATTCA
AATCCCCACCCATCCTGCCCCCTCACCTACTCCAAGTTATTCTTAACAAGGACACGAATA
TTTCATGTGACCCAGCCTTACTTCCTGAGCCCAATCATGTTATGCTGAACCATCTCTATG
CACTGTCCATTAAGGACAGTGTGATGGTCCTTAGCGCAACCCATCGCTACAAGAAGAAGT
ATGTCACCACGCTGCTGTATAAGCCCATCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinPurified: Not_Tested
ProteinExpressed: Protein_Confirmed
SolubleProtein: Protein_Soluble
Find experimental protocols in GO.79335
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pVP33K

pVP33K in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  MBP Forward
Reverse:  T7 Terminator
Description: Bacterial (E. coli) expression, adds N-terminal 6xHis tag, MBP, 3CP cleavage, tetra-cys, Tev cleavage; kanamycin resistance; restriction enzyme cloning (SgfI, PmeI).
Comments: Cloning into this vector will remove the BarCat casstte
Size (bp): 7253
Parent Vector: None
Empty Vector: EvNO00084285
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 16377204
Title: High efficiency single step production of expression plasmids from cDNA clones using the Flexi Vector cloning system

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 5502 6184
promoter T5 T5 promoter 123 169
protease cleavage site TEV TEV protease cleavage site 1415 1435
protease cleavage site 3C 3CP cleavage site 1373 1397
repressor protein gene LacI LacI cds 3842 4858
selectable marker CmR chloramphenicol resistance gene (CmR) 1900 2556
tag His 6xHis tag 237 260
tag MBP MBP tag 267 1363

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : Prkab2
Symbol Nomenclature : Prkab2
SYNONYM : 5730553K21Rik; AW049591; BB124140
Designation : 5'-AMP-activated protein kinase subunit beta-2|AMPK subunit beta-2
Full Nomenclature : protein kinase, AMP-activated, beta 2 non-catalytic subunit
GENEID : 108097
GI : 72384347
GenBank Accession : NM_182997
Mouse Genome Informatics : 1336185
Vega : OTTMUSG00000029934
Target GenBank: NM_182997

 

Clone

Cloning Information : 510896
HIP Master Clone ID : 422063
Original Clone ID : 1683.1.68_GO.79335

Experimental

TargetTrack - Experimental data : GO.79335

Organism


TAX_ID : 10090
Species Specific ID: 108097

Genome

Chromosome : 3
Map Location : 3 F2.2|3
Ensembl : ENSMUSG00000038205

Reagents

Labome : Prkab2-antibody