DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_nHalo_empty


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pJFT7_nHalo_empty              
Source: Center for Personalized Diagnostics
Description: In vitro expression vector with T7 promoter and N-terminal TEV-cleavable Halo tag; does not contain a death cassette; ampicillin resistance; restriction enzyme cloning
Comments: None
Publications: None
Authors: Joshua LaBaer
Justin Saul
Fernanda Festa
Center for Personalized Diagnostics

Price:  Login for Pricing
No restriction
Special MTA: HALO



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJFT7_nHalo_empty

pJFT7_nHalo_empty in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  NAP150
Reverse:  T7 terminator
Description: In vitro expression vector with T7 promoter and N-terminal TEV-cleavable Halo tag; does not contain a death cassette; ampicillin resistance; restriction enzyme cloning
Comments: Modified from pANT7_cGST, expresses Halo without an insert
Size (bp): 6166
Parent Vector: None
Properties: cell-free expression, multiple cloning site, with tag/fusion/marker
Author Name: Joshua LaBaer
Justin Saul
Fernanda Festa
Center for Personalized Diagnostics
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin 1766 2448
bacterial origin M13 Ori M13 origin 3842 4297
enhancer CITE cap-independent translational enhancer (CITE) 17 515
primer HaloseqF HaloseqF forward sequencing primer aagcctgcctaactgcaa 1289 1306
primer M13 forward M13 forward sequencing primer 4441 4458
primer NAP150 NAP150 forward sequencing primer cccattgtatgggatctgatc 388 408
promoter T7 T7 promoter 4457 4481
protease cleavage site TEV TEV protease cleavage site (EDLYFQS) 1422 1442
selectable marker LacZ LacZ alpha gene 4302 4370
selectable marker AmpR Ampicillin resistance gene 2546 3205
tag HALO N-terminal Halo Tag 519 1409
trxn termination sequence T7 term T7 terminator 1526 1544


Species Specific ID: None
Target GenBank: None