DNASU Plasmid Repository • 480.965.5697 | Email

SPP1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SPP1
Gene Name:  secreted phosphoprotein 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH026566.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004261

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 903nts         Open reading frame : 1 to 903
Reference Sequence Alignment

ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAA
CAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGCTTTACAACAAATACCCAGATGCTGTG
GCCACATGGCTAAACCCTGACCCATCTCAGAAGCAGAATCTCCTAGCCCCACAGACCCTT
CCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGATATGGATGATGAAGATGATGAT
GACCATGTGGACAGCCAGGACTCCATTGACTCGAACGACTCTGATGATGTAGATGACACT
GATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGATGAATCTGATGAACTGGTCACT
GATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCACTCCAGTTGTCCCCACAGTAGAC
ACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACTGAGGTCAAAATCTAAGAAGTTT
CGCAGACCTGACATCCAGTACCCTGATGCTACAGACGAGGACATCACCTCACACATGGAA
AGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGTTGCCCAGGACCTGAACGCGCCT
TCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAACGAGTCAGCTGGATGACCAGAGT
GCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGC
AATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCAC
AGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAA
GATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAAT
TTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1004
Start on reference sequence 102
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SPP1
Symbol Nomenclature : SPP1
SYNONYM : BNSP; BSPI; ETA-1; OPN
Designation : SPP1/CALPHA1 fusion|early T-lymphocyte activation 1|nephropontin|osteopontin|osteopontin/immunoglobulin alpha 1 heavy chain constant region fusion protein|secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)|urinary stone protein|uropontin
Full Nomenclature : secreted phosphoprotein 1
GENEID : 6696
Locus Tag : PSEC0156
GI : 60653518
GenBank Accession : AY892536
HGNC : 11255
MIM : 166490
Vega : OTTHUMG00000130599
Target GenBank: BC007016

 

Reference Sequence Alignment

  

HsCD00004261        ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAA
NM_001251830.1      -ATGGGCATTGTCCCCAGAAGCTTGGACAAAAAGGCACACAGAGTTCAATTCCAGTTGAA
NM_000582.2         ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAA
NM_001040060.1      ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAA
NM_001251829.1      ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAA
NM_001040058.1      ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAA
                     : .*..:*  :   .: :.  ** *.*:..:***** ... :** *.**:******.**

HsCD00004261        CAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGCTTTACAACAAATACCCAGATGCTGTG
NM_001251830.1      CAGAATAAAGGCCAAAATAGAGCTGCCTTGGGGGTCACTGCAATTAGACTGCTTAATGAA
NM_000582.2         CAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGCTTTACAACAAATACCCAGATGCTGTG
NM_001040060.1      CAGGCTGATTCTGGAAGTTCTGAGGAAAAGCA----------------------------
NM_001251829.1      CAGGCTGATTCTGGAAGTTCTGAG------------------------------------
NM_001040058.1      CAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGCTTTACAACAAATACCCAGATGCTGTG
                    ***..*.*:    .**.*: :*.                                     

HsCD00004261        GCCACATGG---------------------------------------------------
NM_001251830.1      GACATTAAAAGAACTTTACAACAAATACCCAGATGCTGTGGCCACATGGCTAAACCCTGA
NM_000582.2         GCCACATGG---------------------------------------------------
NM_001040060.1      ------------------------------------------------------------
NM_001251829.1      ------------------------------------------------------------
NM_001040058.1      GCCACATGGC----------------------------------------TAAACCCTGA
                                                                                

HsCD00004261        -------------------------------CTAAACCCTGACCCATCTCAGAAGCAGAA
NM_001251830.1      CCCATCTCAGAAGCAGAATCTCCTAGCCCCACAGAATGCTGTGTCCTCTGAAGAAACCAA
NM_000582.2         -------------------------------CTAAACCCTGACCCATCTCAGAAGCAGAA
NM_001040060.1      ---------------------------------GAATGCTGTGTCCTCTGAAGAAACCAA
NM_001251829.1      ------------------------------------------------------------
NM_001040058.1      CCCATCTCAGAAGCAGAATCTCCTAGCCCCACAGAATGCTGTGTCCTCTGAAGAAACCAA
                                                                                

HsCD00004261        TCTCCTAGCCCCACAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGA
NM_001251830.1      TGACTTTAAACAAGAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGA
NM_000582.2         TCTCCTAGCCCCACAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGA
NM_001040060.1      TGACTTTAAACAAGAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGA
NM_001251829.1      -------GAAAAGCAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGA
NM_001040058.1      TGACTTTAAACAAGAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGA
                           ...... **********************************************

HsCD00004261        TATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGA
NM_001251830.1      TATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGA
NM_000582.2         TATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGA
NM_001040060.1      TATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGA
NM_001251829.1      TATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGA
NM_001040058.1      TATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGA
                    ************************************************************

HsCD00004261        CTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGA
NM_001251830.1      CTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGA
NM_000582.2         CTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGA
NM_001040060.1      CTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGA
NM_001251829.1      CTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGA
NM_001040058.1      CTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGA
                    ************************************************************

HsCD00004261        TGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCAC
NM_001251830.1      TGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCAC
NM_000582.2         TGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCAC
NM_001040060.1      TGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCAC
NM_001251829.1      TGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCAC
NM_001040058.1      TGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCAC
                    ************************************************************

HsCD00004261        TCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACT
NM_001251830.1      TCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACT
NM_000582.2         TCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACT
NM_001040060.1      TCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACT
NM_001251829.1      TCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACT
NM_001040058.1      TCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACT
                    ************************************************************

HsCD00004261        GAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGA
NM_001251830.1      GAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGA
NM_000582.2         GAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGA
NM_001040060.1      GAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGA
NM_001251829.1      GAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGA
NM_001040058.1      GAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGA
                    ************************************************************

HsCD00004261        GGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGT
NM_001251830.1      GGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGT
NM_000582.2         GGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGT
NM_001040060.1      GGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGT
NM_001251829.1      GGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGT
NM_001040058.1      GGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGT
                    ************************************************************

HsCD00004261        TGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAAC
NM_001251830.1      TGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAAC
NM_000582.2         TGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAAC
NM_001040060.1      TGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAAC
NM_001251829.1      TGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAAC
NM_001040058.1      TGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAAC
                    ************************************************************

HsCD00004261        GAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAA
NM_001251830.1      GAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAA
NM_000582.2         GAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAA
NM_001040060.1      GAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAA
NM_001251829.1      GAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAA
NM_001040058.1      GAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAA
                    ************************************************************

HsCD00004261        GCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTC
NM_001251830.1      GCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTC
NM_000582.2         GCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTC
NM_001040060.1      GCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTC
NM_001251829.1      GCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTC
NM_001040058.1      GCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTC
                    ************************************************************

HsCD00004261        CAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGT
NM_001251830.1      CAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGT
NM_000582.2         CAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGT
NM_001040060.1      CAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGT
NM_001251829.1      CAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGT
NM_001040058.1      CAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGT
                    ************************************************************

HsCD00004261        AGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGA
NM_001251830.1      AGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGA
NM_000582.2         AGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGA
NM_001040060.1      AGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGA
NM_001251829.1      AGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGA
NM_001040058.1      AGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGA
                    ************************************************************

HsCD00004261        TAGTGCATCTTCTGAGGTCAATTTG
NM_001251830.1      TAGTGCATCTTCTGAGGTCAATTAA
NM_000582.2         TAGTGCATCTTCTGAGGTCAATTAA
NM_001040060.1      TAGTGCATCTTCTGAGGTCAATTAA
NM_001251829.1      TAGTGCATCTTCTGAGGTCAATTAA
NM_001040058.1      TAGTGCATCTTCTGAGGTCAATTAA
                    ***********************:.

Pathways

NCI : Alpha4 beta1 integrin signaling events
NCI : Alpha9 beta1 integrin signaling events
NCI : Beta1 integrin cell surface interactions
NCI : Beta3 integrin cell surface interactions
NCI : Direct p53 effectors
NCI : FGF signaling pathway
NCI : Integrins in angiogenesis
NCI : Osteopontin-mediated events
Reactome : Degradation of the extracellular matrix
Reactome : Extracellular matrix organization
Reactome : Integrin cell surface interactions
Reactome : Signal Transduction
Reactome : Signaling by PDGF
WikiPathway : Endochondral Ossification
WikiPathway : Focal Adhesion
WikiPathway : Osteoclast Signaling
WikiPathway : Osteopontin Signaling
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : OSTEO : Osteopontin
UniProt : B2RDA1
UniProt : P10451
UniProt : Q567T5
UniProt : Q4W597
HPRD : 01325

Clone

Cloning Information : 26566
HIP Master Clone ID : 56942
Original Clone ID : FLH026566.01L

Organism


TAX_ID : 9606
Species Specific ID: 6696

Genome

Chromosome : 4
Map Location : 4q22.1
Ensembl : ENSG00000118785

Reagents

Labome : osteopontin-antibody