DNASU Plasmid Repository • 480.965.5697 | Email

CSNK2A1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CSNK2A1
Gene Name:  casein kinase 2, alpha 1 polypeptide
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH020226.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000429

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1176nts         Open reading frame : 1 to 1176
Reference Sequence Alignment

ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCT
CGAGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAG
CTGGTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACA
AATAATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGT
GAAATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATT
GTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
TTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATT
CTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTCAAGCCCCAT
AATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAGACTGGGGTTTGGCTGAG
TTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGTCCT
GAGCTACTTGTAGACTATCAGATGTACGATTATAGTTTGGATATGTGGAGTTTGGGTTGT
ATGCTGGCAAGTATGATCTTTCGGAAGGAGCCATTTTTCCATGGACATGACAATTATGAT
CAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGACTATATTGACAAA
TACAACATTGAATTAGATCCACGTTTCAATGATATCTTGGGCAGACACTCTCGAAAGCGA
TGGGAACGCTTTGTCCACAGTGAAAATCAGCACCTTGTCAGCCCTGAGGCCTTGGATTTC
CTGGACAAACTGCTGCGATATGACCACCAGTCACGGCTTACTGCAAGAGAGGCAATGGAG
CACCCCTATTTCTACACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCA
GGGGGCAGTACGCCCGTCAGCAGCGCCAATATGATGTCAGGGATTTCTTCAGTGCCAACC
CCTTCACCCCTTGGACCTCTGGCAGGCTCACCAGTGATTGCTGCTGCCAACCCCCTTGGG
ATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1324
Start on reference sequence 149
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CSNK2A1
Symbol Nomenclature : CSNK2A1
SYNONYM : CK2A1; CKII; CSNK2A3
Designation : CK II alpha 3|CK2 catalytic subunit alpha|casein kinase II alpha 1 polypeptide pseudogene|casein kinase II alpha 1 subunit|casein kinase II subunit alpha|protein kinase CK2
Full Nomenclature : casein kinase 2, alpha 1 polypeptide
GENEID : 1457
GI : 61355746
GenBank Accession : AY888226
HGNC : 2457
MIM : 115440
Target GenBank: NM_001895

 

Reference Sequence Alignment

  

HsCD00000429        ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCT
NM_001256686.1      ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCT
NM_001895.3         ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCT
NM_177559.2         ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCT
                    ************************************************************

HsCD00000429        CGAGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAG
NM_001256686.1      CGAGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAG
NM_001895.3         CGAGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAG
NM_177559.2         CGAGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAG
                    ************************************************************

HsCD00000429        CTGGTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACA
NM_001256686.1      CTGGTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACA
NM_001895.3         CTGGTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACA
NM_177559.2         CTGGTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACA
                    ************************************************************

HsCD00000429        AATAATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGT
NM_001256686.1      AATAATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGT
NM_001895.3         AATAATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGT
NM_177559.2         AATAATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGT
                    ************************************************************

HsCD00000429        GAAATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATT
NM_001256686.1      GAAATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATT
NM_001895.3         GAAATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATT
NM_177559.2         GAAATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATT
                    ************************************************************

HsCD00000429        GTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
NM_001256686.1      GTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
NM_001895.3         GTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
NM_177559.2         GTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
                    ************************************************************

HsCD00000429        TTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATT
NM_001256686.1      TTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATT
NM_001895.3         TTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATT
NM_177559.2         TTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATT
                    ************************************************************

HsCD00000429        CTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTCAAGCCCCAT
NM_001256686.1      CTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTCAAGCCCCAT
NM_001895.3         CTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTCAAGCCCCAT
NM_177559.2         CTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTCAAGCCCCAT
                    ************************************************************

HsCD00000429        AATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAGACTGGGGTTTGGCTGAG
NM_001256686.1      AATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAGACTGGGGTTTGGCTGAG
NM_001895.3         AATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAGACTGGGGTTTGGCTGAG
NM_177559.2         AATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAGACTGGGGTTTGGCTGAG
                    ************************************************************

HsCD00000429        TTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGTCCT
NM_001256686.1      TTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGTCCT
NM_001895.3         TTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGTCCT
NM_177559.2         TTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGTCCT
                    ************************************************************

HsCD00000429        GAGCTACTTGTAGACTATCAGATGTACGATTATAGTTTGGATATGTGGAGTTTGGGTTGT
NM_001256686.1      GAGCTACTTGTAGACTATCAGATGTACGATTATAGTTTGGATATGTGGAGATTGGGTTGT
NM_001895.3         GAGCTACTTGTAGACTATCAGATGTACGATTATAGTTTGGATATGTGGAGTTTGGGTTGT
NM_177559.2         GAGCTACTTGTAGACTATCAGATGTACGATTATAGTTTGGATATGTGGAGTTTGGGTTGT
                    **************************************************:*********

HsCD00000429        ATGCTGGCAAGTATGATCTTTCGGAAGGAGCCATTTTTCCATGGACATGACAATTATGAT
NM_001256686.1      ATGCTGGCAAGTATGATCTTTCGGAAGGAGCCATTTTTCCATGGACGTGACAATTATGAT
NM_001895.3         ATGCTGGCAAGTATGATCTTTCGGAAGGAGCCATTTTTCCATGGACATGACAATTATGAT
NM_177559.2         ATGCTGGCAAGTATGATCTTTCGGAAGGAGCCATTTTTCCATGGACATGACAATTATGAT
                    **********************************************.*************

HsCD00000429        CAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGACTATATTGACAAA
NM_001256686.1      CAGTTGGTGAGGATAGCCAAGTTTCTGGGGACAGAAGATTTATATGGCTATATTGACAAA
NM_001895.3         CAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGACTATATTGACAAA
NM_177559.2         CAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGACTATATTGACAAA
                    ********************* ************************.*************

HsCD00000429        TACAACATTGAATTAGATCCACGTTTCAATGATATCTTGGGCAGACACTCTCGAAAGCGA
NM_001256686.1      TACAACATTGAATTAGATCCACGTTTCAATGATATCTTGGGCAGACACTCTCGAAAGCGA
NM_001895.3         TACAACATTGAATTAGATCCACGTTTCAATGATATCTTGGGCAGACACTCTCGAAAGCGA
NM_177559.2         TACAACATTGAATTAGATCCACGTTTCAATGATATCTTGGGCAGACACTCTCGAAAGCGA
                    ************************************************************

HsCD00000429        TGGGAACGCTTTGTCCACAGTGAAAATCAGCACCTTGTCAGCCCTGAGGCCTTGGATTTC
NM_001256686.1      TGGGAACGCTTTGTCCACAGTGAAAATCAGCACCTTGTCAGCCCTGAGGCCTTGGATTTC
NM_001895.3         TGGGAACGCTTTGTCCACAGTGAAAATCAGCACCTTGTCAGCCCTGAGGCCTTGGATTTC
NM_177559.2         TGGGAACGCTTTGTCCACAGTGAAAATCAGCACCTTGTCAGCCCTGAGGCCTTGGATTTC
                    ************************************************************

HsCD00000429        CTGGACAAACTGCTGCGATATGACCACCAGTCACGGCTTACTGCAAGAGAGGCAATGGAG
NM_001256686.1      CTGGACAAACTGCTGCGATATGACCACCAGTCACGGCTTACTGCAAGAGAGGCCATGGAG
NM_001895.3         CTGGACAAACTGCTGCGATATGACCACCAGTCACGGCTTACTGCAAGAGAGGCAATGGAG
NM_177559.2         CTGGACAAACTGCTGCGATATGACCACCAGTCACGGCTTACTGCAAGAGAGGCAATGGAG
                    *****************************************************.******

HsCD00000429        CACCCCTATTTCTACACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCA
NM_001256686.1      CACCCCTATTTCTACACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCA
NM_001895.3         CACCCCTATTTCTACACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCA
NM_177559.2         CACCCCTATTTCTACACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCA
                    ************************************************************

HsCD00000429        GGGGGCAGTACGCCCGTCAGCAGCGCCAATATGATGTCAGGGATTTCTTCAGTGCCAACC
NM_001256686.1      GGGGGCAGTACGCCCGTCAGCAGCGCCAATGTGATGTCAGGGATTTCTTCAGTGCCAACT
NM_001895.3         GGGGGCAGTACGCCCGTCAGCAGCGCCAATATGATGTCAGGGATTTCTTCAGTGCCAACC
NM_177559.2         GGGGGCAGTACGCCCGTCAGCAGCGCCAATATGATGTCAGGGATTTCTTCAGTGCCAACC
                    ******************************.**************************** 

HsCD00000429        CCTTCACCCCTTGGACCTCTGGCAGGCTCACCAGTGATTGCTGCTGCCAACCCCCTTGGG
NM_001256686.1      CCTTCACCCCTTGGACCTCTGGCAGGCTCACCAGTGATTGCTGCTGCCAACCCCCTTGGG
NM_001895.3         CCTTCACCCCTTGGACCTCTGGCAGGCTCACCAGTGATTGCTGCTGCCAACCCCCTTGGG
NM_177559.2         CCTTCACCCCTTGGACCTCTGGCAGGCTCACCAGTGATTGCTGCTGCCAACCCCCTTGGG
                    ************************************************************

HsCD00000429        ATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAG
NM_001256686.1      ATGCCTGTTCCAGCTGCCACTGGCGCTCAGCAGTAA
NM_001895.3         ATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAA
NM_177559.2         ATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAA
                    ******************.****************.

Pathways

NCI : Alpha-synuclein signaling
NCI : Atypical NF-kappaB pathway
NCI : BCR signaling pathway
NCI : DNA-PK pathway in nonhomologous end joining
NCI : E-cadherin signaling in the nascent adherens junction
NCI : Lissencephaly gene (LIS1) in neuronal migration and development
NCI : PDGFR-alpha signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling mediated by p38-alpha and p38-beta
Panther : Cadherin signaling pathway
Panther : Parkinson disease
Panther : Wnt signaling pathway
Reactome : Axon guidance
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Condensation of Prometaphase Chromosomes
Reactome : Developmental Biology
Reactome : L1CAM interactions
Reactome : M Phase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prometaphase
Reactome : Signal Transduction
Reactome : Signal transduction by L1
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : WNT mediated activation of DVL
WikiPathway : TNF alpha Signaling Pathway

Protein

SMART domain : S_TKc : Serine/Threonine protein kinases, catalytic domain
SMART domain : TyrKc : Tyrosine kinase, catalytic domain
UniProt : P68400
UniProt : B4DYS6
HPRD : 00277

Clone

Cloning Information : 20226
HIP Master Clone ID : 36322
Original Clone ID : FLH020226.01X

Organism


TAX_ID : 9606
Species Specific ID: 1457

Genome

Chromosome : 20
Map Location : 20p13

Reagents

Labome : CSNK2A1-antibody