DNASU Plasmid Repository • 480.965.5697 | Email

POLR2K (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POLR2K
Gene Name:  polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH169953.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00043176

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 177nts         Open reading frame : 1 to 177
Reference Sequence Alignment

ATGGACACCCAGAAGGACGTTCAACCTCCAAAGCAGCAACCAATGATATATATCTGTGGA
GAGTGTCACACAGAAAATGAAATAAAATCTAGGGATCCAATCAGATGCAGAGAATGTGGA
TACAGAATAATGTACAAGAAAAGGACTAAAAGATTGGTCGTTTTTGATGCTCGATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 243
Start on reference sequence 67
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POLR2K
Symbol Nomenclature : POLR2K
SYNONYM : ABC10-alpha; RPABC4; RPB10alpha; RPB12; RPB7.0; hRPB7.0; hsRPB10a
Designation : DNA directed RNA polymerases I, II, and III 7.0 kda polypeptide|DNA-directed RNA polymerase II subunit K|DNA-directed RNA polymerases I, II, and III subunit RPABC4|RNA polymerase II 7.0 kDa subunit|RNA polymerases I, II, and III subunit ABC4
Full Nomenclature : polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
GENEID : 5440
HGNC : 9198
MIM : 606033
Vega : OTTHUMG00000164705
Target GenBank: BC000806

 

Reference Sequence Alignment

  

HsCD00043176      ATGGACACCCAGAAGGACGTTCAACCTCCAAAGCAGCAACCAATGATATATATCTGTGGA
NM_005034.3       ATGGACACCCAGAAGGACGTTCAACCTCCAAAGCAGCAACCAATGATATATATCTGTGGA
                  ************************************************************

HsCD00043176      GAGTGTCACACAGAAAATGAAATAAAATCTAGGGATCCAATCAGATGCAGAGAATGTGGA
NM_005034.3       GAGTGTCACACAGAAAATGAAATAAAATCTAGGGATCCAATCAGATGCAGAGAATGTGGA
                  ************************************************************

HsCD00043176      TACAGAATAATGTACAAGAAAAGGACTAAAAGATTGGTCGTTTTTGATGCTCGATAG
NM_005034.3       TACAGAATAATGTACAAGAAAAGGACTAAAAGATTGGTCGTTTTTGATGCTCGATGA
                  *******************************************************..

Pathways

Panther : General transcription by RNA polymerase I
Reactome : Abortive elongation of HIV-1 transcript in the absence of Tat
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Repair
Reactome : Disease
Reactome : Dual incision reaction in TC-NER
Reactome : Elongation arrest and recovery
Reactome : Epigenetic regulation of gene expression
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV Transcription Initiation
Reactome : HIV elongation arrest and recovery
Reactome : Immune System
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Influenza Viral RNA Transcription and Replication
Reactome : Innate Immune System
Reactome : Late Phase of HIV Life Cycle
Reactome : MicroRNA (miRNA) biogenesis
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : Nucleotide Excision Repair
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : RNA Pol II CTD phosphorylation and interaction with CE
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Escape
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I Transcription Termination
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase II HIV Promoter Escape
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Promoter Escape
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Initiation
Reactome : RNA Polymerase II Transcription Initiation And Promoter Clearance
Reactome : RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
Reactome : RNA Polymerase III Abortive And Retractive Initiation
Reactome : RNA Polymerase III Chain Elongation
Reactome : RNA Polymerase III Transcription
Reactome : RNA Polymerase III Transcription Initiation
Reactome : RNA Polymerase III Transcription Initiation From Type 1 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 2 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 3 Promoter
Reactome : RNA Polymerase III Transcription Termination
Reactome : Regulatory RNA pathways
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)
Reactome : Viral Messenger RNA Synthesis
Reactome : mRNA Capping
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
Reactome : mRNA Splicing - Minor Pathway
WikiPathway : Eukaryotic Transcription Initiation

Protein

SMART domain : RPOLCX : RNA polymerase subunit CX
UniProt : P53803
HPRD : 05826

Clone

Cloning Information : 169953
HIP Master Clone ID : 143419
Original Clone ID : FLH169953.01X

Organism


TAX_ID : 9606
Species Specific ID: 5440

Genome

Chromosome : 8
Map Location : 8q22.2
Ensembl : ENSG00000147669

Reagents

Labome : POLR2K-antibody