DNASU Plasmid Repository • 480.965.5697 | Email

SAV0321 (S. aureus subsp. aureus Mu50 ) in pMCSG19 (MBP and His-tagged expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SAV0321
Gene Name:  hypothetical protein
Sequence             
Original Clone ID: APC61011_SG123_pMCSG19
Keyword: full length
Species: Staphylococcus aureus subsp. aureus Mu50
Type: cDNA
Vector Name: pMCSG19               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
Midwest Center for Structural Genomics
SaCD00432683

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 828nts        
Open reading frame : 19 to 846

GTACTTCCATCCAATGCCGTGACTGAAATTAAATATAAAGTAATTACTAAAGATGCATTT
GCATTACCTTACACAATTATTAAAGCAAAAAATCAACCAACAAAAGGCGCTATTGTCTAC
ATCCACGGTGGTGGATTAATGTTCGGTAAAGCTAACGATTTATCCCCACAGTATATCGAT
ATCCTTACGGAACATTACGATTTAATTCAACTAAGTTATCGTTTATTACCAGAAGTAAGT
CTCGATTGCATTATTGAGGATGTCTACGCATCATTCGATGCGATTCAATCACAATATTCT
AATTGCCCTATTTTTACCTTTGGCAGATCATCAGGTGCATATTTAAGTCTATTAATTGCA
CGAGACAGAGATATTGATGGTGTTATTGATTTTTATGGTTATAGTCGCATCAACACTGAA
CCTTTTAAAACAACTAATAGTTATTACGCAAAAATAGCTCAAAGCGTAAACGAAACAATG
ATTGCACAACTCACTTCACCAACACCGGTTGTTCAAGATCAAATCGCACAACGTTTTTTA
ATCTACGTTTATGCACGTGGCACAGGTAAATGGATAAATATGATTAACATTGCTGATTAT
ACTAATTCAAAATATAATATTGCACCAGATGAACTTAAAACACTTCCACCTGTTTTCATT
GCGCATTGTAATGGCGATTATGATGTTCCCGTTGAGGAAAGCGAACATATCATGAATCAT
GTTCCACATTCAACATTTGAACGCGTGAATAAAAACGAGCATGATTTTGATCGTAGACCT
AATGACGAAGCAATCACTATTTATCGTAAAGTTGTTGATTTCTTAAACGCTATAACAATG
GTGTAACATTGGAAGTGGATAACGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
t92c,V31A;a448g,I150V;
g586a,D196N
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in APC61011
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG19

pMCSG19 in advanced viewed

Synonyms: pMCSG-19
Sequencing Primer: Forward:  ANForward
Reverse:  T7 terminator
Description: Vector for solubility of insert and for purification, with T7 promoter, adds N-terminal MBP, TVMV, His, TEV, NA; amp resistance; ligation independent cloning (LIC).
Comments: pMCSG7 derivative: in vivo TVMV cleavage of MBP
Size (bp): 6441
Parent Vector: None
Empty Vector: EvNO00084265
Properties: bacterial expression, improves solubility of insert, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 16497515
Title: An expression vector tailored for large-scale, high-throughput purification of recombinant proteins

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC Ligation independent cloning (LIC) site 204 235
bacterial origin ori ColE1-type bacterial origin of replication 4416 5098
promoter T7 T7 promoter 1515 1531
protease cleavage site TEV TEV cleavage site cds 223 243
protease cleavage site TVMV TVMV protease cleavage site 286 306
repressor binding site lac operator LacO fragment 1490 1512
repressor protein gene LacI LacI coding sequence 2045 3004
selectable marker AmpR ampicillin resistance gene 5193 6053
tag His 6xHis tag 268 285
tag His 2 C-terminal 6xHis tag 140 157
tag MBP N-terminal MBP 337 1443
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : SAV0321
GENEID : 1120279
Locus Tag : SAV0321
GI : 14246089
Target GenBank: None

 

Protein

PDB - Structural Annotation : 3H04
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 493593
HIP Master Clone ID : 407273
Original Clone ID : APC61011_SG123_pMCSG19

Experimental

Structural Biology Knowledgebase : SBKB (3H04)
TargetTrack - Experimental data : APC61011

Organism


TAX_ID : 158878
Species Specific ID: 1120279

Reagents

Labome : SAV0321-cDNA