DNASU Plasmid Repository • 480.965.5697 | Email

VAV1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  VAV1
Gene Name:  vav 1 guanine nucleotide exchange factor
Sequence             
Original Clone ID: VAV1_pDONR221_closed
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
Brianne Petritis
HsCD00433454

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2373nts         Open reading frame : 1 to 2373
Reference Sequence Alignment

ATGATTGTGCTACCACTGTACTCCAGACTGGACAAAAGATTCCTGTGCCTTAAGAACATT
AGAACCTTCCTGTCCACCTGCTGTGAGAAGTTCGGCCTCAAGCGGAGCGAGCTCTTCGAA
GCCTTTGACCTCTTCGATGTGCAGGATTTTGGCAAGGTCATCTACACCCTGTCTGCTCTG
TCCTGGACCCCGATCGCCCAGAACAGGGGGATCATGCCCTTCCCCACCGAGGAGGAGAGT
GTAGGTGATGAAGACATCTACAGTGGCCTGTCCGACCAGATCGACGACACGGTGGAGGAG
GATGAGGACCTGTATGACTGCGTGGAGAATGAGGAGGCGGAAGGCGACGAGATCTATGAG
GACCTCATGCGCTCGGAGCCCGTGTCCATGCCGCCCAAGATGACAGAGTATGACAAGCGC
TGCTGCTGCCTGCGGGAGATCCAGCAGACGGAGGAGAAGTACACTGACACGCTGGGCTCC
ATCCAGCAGCATTTCTTGAAGCCCCTGCAACGGTTCCTGAAACCTCAAGACATTGAGATC
ATCTTTATCAACATTGAGGACCTGCTTCGTGTTCATACTCACTTCCTAAAGGAGATGAAG
GAAGCCCTGGGCACCCCTGGCGCAGCCAATCTCTACCAGGTCTTCATCAAATACAAGGAG
AGGTTCCTCGTCTATGGCCGCTACTGCAGCCAGGTGGAGTCAGCCAGCAAACACCTGGAC
CGTGTGGCCGCAGCCCGGGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGAGAGCC
AACAACGGGAGGTTCACCCTGCGGGACCTGCTGATGGTGCCTATGCAGCGAGTTCTCAAA
TATCACCTCCTTCTCCAGGAGCTGGTGAAACACACGCAGGAGGCGATGGAGAAGGAGAAC
CTGCGGCTGGCCCTGGATGCCATGAGGGACCTGGCTCAGTGCGTGAACGAGGTCAAGCGA
GACAACGAGACACTGCGACAGATCACCAATTTCCAGCTGTCCATTGAGAACCTGGACCAG
TCTCTGGCTCACTATGGCCGGCCCAAGATCGACGGGGAACTCAAGATCACCTCGGTGGAA
CGGCGCTCCAAGATGGACAGGTATGCCTTCCTGCTCGACAAAGCTCTACTCATCTGTAAG
CGCAGGGGAGACTCCTATGACCTCAAGGACTTTGTAAACCTGCACAGCTTCCAGGTTCGG
GATGACTCTTCAGGAGACCGAGACAACAAGAAGTGGAGCCACATGTTCCTCCTGATCGAG
GACCAAGGTGCCCAGGGCTATGAGCTGTTCTTCAAGACAAGAGAATTGAAGAAGAAGTGG
ATGGAGCAGTTTGAGATGGCCATCTCCAACATCTATCCGGAGAATGCCACCGCCAACGGG
CATGACTTCCAGATGTTCTCCTTTGAGGAGACCACATCCTGCAAGGCCTGTCAGATGCTG
CTTAGAGGTACCTTCTATCAGGGCTACCGCTGCCATCGGTGCCGGGCATCTGCACACAAG
GAGTGTCTGGGGAGGGTCCCTCCATGTGGCCGACATGGGCAAGATTTCCCAGGAACTATG
AAGAAGGACAAACTACATCGCAGGGCTCAGGACAAAAAGAGGAATGAGCTGGGTCTGCCC
AAGATGGAGGTGTTTCAGGAATACTACGGGCTTCCTCCACCCCCTGGAGCCATTGGACCC
TTTCTACGGCTCAACCCTGGAGACATTGTGGAGCTCACGAAGGCTGAGGCTGAACAGAAC
TGGTGGGAGGGCAGAAATACATCTACTAATGAAATTGGCTGGTTTCCTTGTAACAGGGTG
AAGCCCTATGTCCATGGCCCTCCTCAGGACCTGTCTGTTCATCTCTGGTACGCAGGCCCC
ATGGAGCGGGCAGGGGCAGAGAGCATCCTGGCCAACCGCTCGGACGGGACTTTCTTGGTG
CGGCAGAGGGTGAAGGATGCAGCAGAATTTGCCATCAGCATTAAATATAACGTCGAGGTC
AAGCACATTAAAATCATGACAGCAGAAGGACTGTACCGGATCACAGAGAAAAAGGCTTTC
CGGGGGCTTACGGAGCTGGTGGAGTTTTACCAGCAGAACTCTCTAAAGGATTGCTTCAAG
TCTCTGGACACCACCTTGCAGTTCCCCTTCAAGGAGCCTGAAAAGAGAACCATCAGCAGG
CCAGCAGTGGGAAGCACAAAGTATTTTGGCACAGCCAAAGCCCGCTATGACTTCTGCGCC
CGAGACCGATCAGAGCTGTCGCTCAAGGAGGGTGACATCATCAAGATCCTTAACAAGAAG
GGACAGCAAGGCTGGTGGCGAGGGGAGATCTATGGCCGGGTTGGCTGGTTCCCTGCCAAC
TACGTGGAGGAAGATTATTCTGAATACTGCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : VAV1
Symbol Nomenclature : VAV1
SYNONYM : VAV
Designation : proto-oncogene vav|vav 1 oncogene
Full Nomenclature : vav 1 guanine nucleotide exchange factor
GENEID : 7409
GenBank Accession : BC013361
HGNC : 12657
MIM : 164875
Vega : OTTHUMG00000181965
Target GenBank: BC013361

 

Reference Sequence Alignment

  

HsCD00433454        ------------------------------------------------------------
NM_005428.3         ATGGAGCTGTGGCGCCAATGCACCCACTGGCTCATCCAGTGCCGGGTGCTGCCGCCCAGC
NM_001258207.1      ATGGAGCTGTGGCGCCAATGCACCCACTGGCTCATCCAGTGCCGGGTGCTGCCGCCCAGC
NM_001258206.1      ATGGAGCTGTGGCGCCAATGCACCCACTGGCTCATCCAGTGCCGGGTGCTGCCGCCCAGC
                                                                                

HsCD00433454        ------------------------------------------------------------
NM_005428.3         CACCGCGTGACCTGGGATGGGGCTCAGGTGTGTGAACTGGCCCAGGCCCTCCGGGATGGT
NM_001258207.1      CACCGCGTGACCTGGGATGGGGCTCAGGTGTGTGAACTGGCCCAGGCCCTCCGGGATGGT
NM_001258206.1      CACCGCGTGACCTGGGATGGGGCTCAGGTGTGTGAACTGGCCCAGGCCCTCCGGGATGGT
                                                                                

HsCD00433454        ---------------------ATGATTGTGCTACCACTGTACTCCAGACTGG--------
NM_005428.3         GTCCTTCTGTGTCAGCTGCTTAACAACCTGCTACCCCATGCCATCAACCTGCGTGAGGTC
NM_001258207.1      GTCCTTCTGTGTCAGCTGCTTAACAACCTGCTACCCCATGCCATCAACCTGCGTGAGGTC
NM_001258206.1      GTCCTTCTGTGTCAGCTGCTTAACAACCTGCTACCCCATGCCATCAACCTGCGTGAGGTC
                                         *: *:  *******.*:  .*: **..***         

HsCD00433454        ----------------ACAAAAGATTCCTGTGCCTTAAGAACATTAGAACCTTCCTGTCC
NM_005428.3         AACCTGCGCCCCCAGATGTCCCAGTTCCTGTGCCTTAAGAACATTAGAACCTTCCTGTCC
NM_001258207.1      AACCTGCGCCCCCAGATGTCCCAGTTCCTGTGCCTTAAGAACATTAGAACCTTCCTGTCC
NM_001258206.1      AACCTGCGCCCCCAGATGTCCCAGTTCCTGTGCCTTAAGAACATTAGAACCTTCCTGTCC
                                    : :.....************************************

HsCD00433454        ACCTGCTGTGAGAAGTTCGGCCTCAAGCGGAGCGAGCTCTTCGAAGCCTTTGACCTCTTC
NM_005428.3         ACCTGCTGTGAGAAGTTCGGCCTCAAGCGGAGCGAGCTCTTCGAAGCCTTTGACCTCTTC
NM_001258207.1      ACCTGCTGTGAGAAGTTCGGCCTCAAGCGGAGCGAGCTCTTCGAAGCCTTTGACCTCTTC
NM_001258206.1      ACCTGCTGTGAGAAGTTCGGCCTCAAGCGGAGCGAGCTCTTCGAAGCCTTTGACCTCTTC
                    ************************************************************

HsCD00433454        GATGTGCAGGATTTTGGCAAGGTCATCTACACCCTGTCTGCTCTGTCCTGGACCCCGATC
NM_005428.3         GATGTGCAGGATTTTGGCAAGGTCATCTACACCCTGTCTGCTCTGTCCTGGACCCCGATC
NM_001258207.1      GATGTGCAGGATTTTGGCAAGGTCATCTACACCCTGTCTGCTCTGTCCTGGACCCCGATC
NM_001258206.1      GATGTGCAGGATTTTGGCAAGGTCATCTACACCCTGTCTGCTCTGTCCTGGACCCCGATC
                    ************************************************************

HsCD00433454        GCCCAGAACAGGGGGATCATGCCCTTCCCCACCGAGGAGGAGAGTGTAGGTGATGAAGAC
NM_005428.3         GCCCAGAACAGGGGGATCATGCCCTTCCCCACCGAGGAGGAGAGTGTAGGTGATGAAGAC
NM_001258207.1      GCCCAGAACAGGGGGATCATGCCCTTCCCCACCGAGGAGGAGAGTGTAGGTGATGAAGAC
NM_001258206.1      GCCCAGAACAGGGGGATCATGCCCTTCCCCACCGAGGAGGAGAGTGTAGGTGATGAAGAC
                    ************************************************************

HsCD00433454        ATCTACAGTGGCCTGTCCGACCAGATCGACGACACGGTGGAGGAGGATGAGGACCTGTAT
NM_005428.3         ATCTACAGTGGCCTGTCCGACCAGATCGACGACACGGTGGAGGAGGATGAGGACCTGTAT
NM_001258207.1      ATCTACAGTGGCCTGTCCGACCAGATCGACGACACGGTGGAGGAGGATGAGGACCTGTAT
NM_001258206.1      ATCTACAGTGGCCTGTCCGACCAGATCGACGACACGGTGGAGGAGGATGAGGACCTGTAT
                    ************************************************************

HsCD00433454        GACTGCGTGGAGAATGAGGAGGCGGAAGGCGACGAGATCTATGAGGACCTCATGCGCTCG
NM_005428.3         GACTGCGTGGAGAATGAGGAGGCGGAAGGCGACGAGATCTATGAGGACCTCATGCGCTCG
NM_001258207.1      GACTGCGTGGAGAATGAGGAGGCGGAAGGCGACGAGATCTATGAGGACCTCATGCGCTCG
NM_001258206.1      GACTGCGTGGAGAATGAGGAGGCGGAAGGCGACGAGATCTATGAGGACCTCATGCGCTCG
                    ************************************************************

HsCD00433454        GAGCCCGTGTCCATGCCGCCCAAGATGACAGAGTATGACAAGCGCTGCTGCTGCCTGCGG
NM_005428.3         GAGCCCGTGTCCATGCCGCCCAAGATGACAGAGTATGACAAGCGCTGCTGCTGCCTGCGG
NM_001258207.1      GAGCCCGTGTCCAT----------------------------------------------
NM_001258206.1      GAGCCCGTGTCCATGCCGCCCAAGATGACAGAGTATGACAAGCGCTGCTGCTGCCTGCGG
                    **************                                              

HsCD00433454        GAGATCCAGCAGACGGAGGAGAAGTACACTGACACGCTGGGCTCCATCCAGCAGCATTTC
NM_005428.3         GAGATCCAGCAGACGGAGGAGAAGTACACTGACACGCTGGGCTCCATCCAGCAGCATTTC
NM_001258207.1      --------------------------------------------------GCCGCATTTC
NM_001258206.1      GAGATCCAGCAGACGGAGGAGAAGTACACTGACACGCTGGGCTCCATCCAGCAGCATTTC
                                                                      **.*******

HsCD00433454        TTGAAGCCCCTGCAACGGTTCCTGAAACCTCAAGACATTGAGATCATCTTTATCAACATT
NM_005428.3         TTGAAGCCCCTGCAACGGTTCCTGAAACCTCAAGACATTGAGATCATCTTTATCAACATT
NM_001258207.1      TTGAAGCCCCTGCAACGGTTCCTGAAACCTCAAGACATTGAGATCATCTTTATCAACATT
NM_001258206.1      TTGAAGCCCCTGCAACGGTTCCTGAAACCTCAAGACATTGAGATCATCTTTATCAACATT
                    ************************************************************

HsCD00433454        GAGGACCTGCTTCGTGTTCATACTCACTTCCTAAAGGAGATGAAGGAAGCCCTGGGCACC
NM_005428.3         GAGGACCTGCTTCGTGTTCATACTCACTTCCTAAAGGAGATGAAGGAAGCCCTGGGCACC
NM_001258207.1      GAGGACCTGCTTCGTGTTCATACTCACTTCCTAAAGGAGATGAAGGAAGCCCTGGGCACC
NM_001258206.1      GAGGACCTGCTTCGTGTTCATACTCACTTCCTAAAGGAGATGAAGGAAGCCCTGGGCACC
                    ************************************************************

HsCD00433454        CCTGGCGCAGCCAATCTCTACCAGGTCTTCATCAAATACAAGGAGAGGTTCCTCGTCTAT
NM_005428.3         CCTGGCGCAGCCAATCTCTACCAGGTCTTCATCAAATACAAGGAGAGGTTCCTCGTCTAT
NM_001258207.1      CCTGGCGCAGCCAATCTCTACCAGGTCTTCATCAAATACAAGGAGAGGTTCCTCGTCTAT
NM_001258206.1      CCTGGCGCAGCCAATCTCTACCAGGTCTTCATCAAATACAAGGAGAGGTTCCTCGTCTAT
                    ************************************************************

HsCD00433454        GGCCGCTACTGCAGCCAGGTGGAGTCAGCCAGCAAACACCTGGACCGTGTGGCCGCAGCC
NM_005428.3         GGCCGCTACTGCAGCCAGGTGGAGTCAGCCAGCAAACACCTGGACCGTGTGGCCGCAGCC
NM_001258207.1      GGCCGCTACTGCAGCCAGGTGGAGTCAGCCAGCAAACACCTGGACCGTGTGGCCGCAGCC
NM_001258206.1      GGCCGCTACTGCAGCCAGGTGGAGTCAGCCAGCAAACACCTGGACCGTGTGGCCGCAGCC
                    ************************************************************

HsCD00433454        CGGGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGAGAGCCAACAACGGGAGGTTC
NM_005428.3         CGGGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGAGAGCCAACAACGGGAGGTTC
NM_001258207.1      CGGGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGAGAGCCAACAACGGGAGGTTC
NM_001258206.1      CGGGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGAGAGCCAACAACGGGAGGTTC
                    ************************************************************

HsCD00433454        ACCCTGCGGGACCTGCTGATGGTGCCTATGCAGCGAGTTCTCAAATATCACCTCCTTCTC
NM_005428.3         ACCCTGCGGGACCTGCTGATGGTGCCTATGCAGCGAGTTCTCAAATATCACCTCCTTCTC
NM_001258207.1      ACCCTGCGGGACCTGCTGATGGTGCCTATGCAGCGAGTTCTCAAATATCACCTCCTTCTC
NM_001258206.1      ACCCTGCGGGACCTGCTGATGGTGCCTATGCAGCGAGTTCTCAAATATCACCTCCTTCTC
                    ************************************************************

HsCD00433454        CAGGAGCTGGTGAAACACACGCAGGAGGCGATGGAGAAGGAGAACCTGCGGCTGGCCCTG
NM_005428.3         CAGGAGCTGGTGAAACACACGCAGGAGGCGATGGAGAAGGAGAACCTGCGGCTGGCCCTG
NM_001258207.1      CAGGAGCTGGTGAAACACACGCAGGAGGCGATGGAGAAGGAGAACCTGCGGCTGGCCCTG
NM_001258206.1      CAGGAGCTGGTGAAACACACGCAGGAGGCGATGGAGAAGGAGAACCTGCGGCTGGCCCTG
                    ************************************************************

HsCD00433454        GATGCCATGAGGGACCTGGCTCAGTGCGTGAACGAGGTCAAGCGAGACAACGAGACACTG
NM_005428.3         GATGCCATGAGGGACCTGGCTCAGTGCGTGAACGAGGTCAAGCGAGACAACGAGACACTG
NM_001258207.1      GATGCCATGAGGGACCTGGCTCAGTGCGTGAACGAGGTCAAGCGAGACAACGAGACACTG
NM_001258206.1      GATGCCATGAGGGACCTGGCTCAGTGCGTGAACGAGGTCAAGCGAGACAACGAGACACTG
                    ************************************************************

HsCD00433454        CGACAGATCACCAATTTCCAGCTGTCCATTGAGAACCTGGACCAGTCTCTGGCTCACTAT
NM_005428.3         CGACAGATCACCAATTTCCAGCTGTCCATTGAGAACCTGGACCAGTCTCTGGCTCACTAT
NM_001258207.1      CGACAGATCACCAATTTCCAGCTGTCCATTGAGAACCTGGACCAGTCTCTGGCTCACTAT
NM_001258206.1      CGACAGATCACCAATTTCCAGCTGTCCATTGAGAACCTGGACCAGTCTCTGGCTCACTAT
                    ************************************************************

HsCD00433454        GGCCGGCCCAAGATCGACGGGGAACTCAAGATCACCTCGGTGGAACGGCGCTCCAAGATG
NM_005428.3         GGCCGGCCCAAGATCGACGGGGAACTCAAGATCACCTCGGTGGAACGGCGCTCCAAGATG
NM_001258207.1      GGCCGGCCCAAGATCGACGGGGAACTCAAGATCACCTCGGTGGAACGGCGCTCCAAGATG
NM_001258206.1      GGCCGGCCCAAGATCGACGGGGAACTCAAGATCACCTCGGTGGAACGGCGCTCCAAGATG
                    ************************************************************

HsCD00433454        GACAGGTATGCCTTCCTGCTCGACAAAGCTCTACTCATCTGTAAGCGCAGGGGAGACTCC
NM_005428.3         GACAGGTATGCCTTCCTGCTCGACAAAGCTCTACTCATCTGTAAGCGCAGGGGAGACTCC
NM_001258207.1      GACAGGTATGCCTTCCTGCTCGACAAAGCTCTACTCATCTGTAAGCGCAGGGGAGACTCC
NM_001258206.1      GACAGGTATGCCTTCCTGCTCGACAAAGCTCTACTCATCTGTAAGCGCAGGGGAGACTCC
                    ************************************************************

HsCD00433454        TATGACCTCAAGGACTTTGTAAACCTGCACAGCTTCCAGGTTCGGGATGACTCTTCAGGA
NM_005428.3         TATGACCTCAAGGACTTTGTAAACCTGCACAGCTTCCAGGTTCGGGATGACTCTTCAGGA
NM_001258207.1      TATGACCTCAAGGACTTTGTAAACCTGCACAGCTTCCAGGTTCGGGATGACTCTTCAGGA
NM_001258206.1      TATGACCTCAAGGACTTTGTAAACCTGCACAGCTTCCAGGTTCGGGATGACTCTTCAGGA
                    ************************************************************

HsCD00433454        GACCGAGACAACAAGAAGTGGAGCCACATGTTCCTCCTGATCGAGGACCAAGGTGCCCAG
NM_005428.3         GACCGAGACAACAAGAAGTGGAGCCACATGTTCCTCCTGATCGAGGACCAAGGTGCCCAG
NM_001258207.1      GACCGAGACAACAAGAAGTGGAGCCACATGTTCCTCCTGATCGAGGACCAAGGTGCCCAG
NM_001258206.1      GACCGAGACAACAAGAAGTGGAGCCACATGTTCCTCCTGATCGAGGACCAAGGTGCCCAG
                    ************************************************************

HsCD00433454        GGCTATGAGCTGTTCTTCAAGACAAGAGAATTGAAGAAGAAGTGGATGGAGCAGTTTGAG
NM_005428.3         GGCTATGAGCTGTTCTTCAAGACAAGAGAATTGAAGAAGAAGTGGATGGAGCAGTTTGAG
NM_001258207.1      GGCTATGAGCTGTTCTTCAAGACAAGAGAATTGAAGAAGAAGTGGATGGAGCAGTTTGAG
NM_001258206.1      GGCTATGAGCTGTTCTTCAAGACAAGAGAATTGAAGAAGAAGTGGATGGAGCAGTTTGAG
                    ************************************************************

HsCD00433454        ATGGCCATCTCCAACATCTATCCGGAGAATGCCACCGCCAACGGGCATGACTTCCAGATG
NM_005428.3         ATGGCCATCTCCAACATCTATCCGGAGAATGCCACCGCCAACGGGCATGACTTCCAGATG
NM_001258207.1      ATGGCCATCTCCAACATCTATCCGGAGAATGCCACCGCCAACGGGCATGACTTCCAGATG
NM_001258206.1      ATGGCCATCTCCAACATCTATCCGGAGAATGCCACCGCCAACGGGCATGACTTCCAGATG
                    ************************************************************

HsCD00433454        TTCTCCTTTGAGGAGACCACATCCTGCAAGGCCTGTCAGATGCTGCTTAGAGGTACCTTC
NM_005428.3         TTCTCCTTTGAGGAGACCACATCCTGCAAGGCCTGTCAGATGCTGCTTAGAGGTACCTTC
NM_001258207.1      TTCTCCTTTGAGGAGACCACATCCTGCAAGGCCTGTCAGATGCTGCTTAGAGGTACCTTC
NM_001258206.1      TTCTCCTTTGAGGAGACCACATCCTGCAAGGCCTGTCAGATGCTGCTTAGAGGTACCTTC
                    ************************************************************

HsCD00433454        TATCAGGGCTACCGCTGCCATCGGTGCCGGGCATCTGCACACAAGGAGTGTCTGGGGAGG
NM_005428.3         TATCAGGGCTACCGCTGCCATCGGTGCCGGGCATCTGCACACAAGGAGTGTCTGGGGAGG
NM_001258207.1      TATCAGGGCTACCGCTGCCATCGGTGCCGGGCATCTGCACACAAGGAGTGTCTGGGGAGG
NM_001258206.1      TATCAGGGCTACCGCTGCCATCGGTGCCGGGCATCTGCACACAAGGAGTGTCTGGGGAGG
                    ************************************************************

HsCD00433454        GTCCCTCCATGTGGCCGACATGGGCAAGATTTCCCAGGAACTATGAAGAAGGACAAACTA
NM_005428.3         GTCCCTCCATGTGGCCGACATGGGCAAGATTTCCCAGGAACTATGAAGAAGGACAAACTA
NM_001258207.1      GTCCCTCCATGTGGCCGACATGGGCAAGATTTCCCAGGAACTATGAAGAAGGACAAACTA
NM_001258206.1      GTCCCTCCATGTGGCCGACATGGGCAAGATTTCCCAGGAACTATGAAGAAGGACAAACTA
                    ************************************************************

HsCD00433454        CATCGCAGGGCTCAGGACAAAAAGAGGAATGAGCTGGGTCTGCCCAAGATGGAGGTGTTT
NM_005428.3         CATCGCAGGGCTCAGGACAAAAAGAGGAATGAGCTGGGTCTGCCCAAGATGGAGGTGTTT
NM_001258207.1      CATCGCAGGGCTCAGGACAAAAAGAGGAATGAGCTGGGTCTGCCCAAGATGGAGGTGTTT
NM_001258206.1      CATCGCAGGGCTCAGGACAAAAAGAGGAATGAGCTGGGTCTGCCCAAGATGGAGGTGTTT
                    ************************************************************

HsCD00433454        CAGGAATACTACGGGCTTCCTCCACCCCCTGGAGCCATTGGACCCTTTCTACGGCTCAAC
NM_005428.3         CAGGAATACTACGGGCTTCCTCCACCCCCTGGAGCCATTGGACCCTTTCTACGGCTCAAC
NM_001258207.1      CAGGAATACTACGGGCTTCCTCCACCCCCTGGAGCCATTGGACCCTTTCTACGGCTCAAC
NM_001258206.1      CAGGAATACTACGGGCTTCCTCCACCCCCTGGAGCCATTGGACCCTTTCTACGGCTCAAC
                    ************************************************************

HsCD00433454        CCTGGAGACATTGTGGAGCTCACGAAGGCTGAGGCTGAACAGAACTGGTGGGAGGGCAGA
NM_005428.3         CCTGGAGACATTGTGGAGCTCACGAAGGCTGAGGCTGAACAGAACTGGTGGGAGGGCAGA
NM_001258207.1      CCTGGAGACATTGTGGAGCTCACGAAGGCTGAGGCTGAACAGAACTGGTGGGAGGGCAGA
NM_001258206.1      CCTGGAGACATTGTGGAGCTCACGAAGGCTGAGGCTGAACAGAACTGGTGGGAGG-----
                    *******************************************************     

HsCD00433454        AATACATCTACTAATGAAATTGGCTGGTTTCCTTGTAACAGGGTGAAGCCCTATGTCCAT
NM_005428.3         AATACATCTACTAATGAAATTGGCTGGTTTCCTTGTAACAGGGTGAAGCCCTATGTCCAT
NM_001258207.1      AATACATCTACTAATGAAATTGGCTGGTTTCCTTGTAACAGGGTGAAGCCCTATGTCCAT
NM_001258206.1      ------------------------------------------------------------
                                                                                

HsCD00433454        GGCCCTCCTCAGGACCTGTCTGTTCATCTCTGGTACGCAGGCCCCATGGAGCGGGCAGGG
NM_005428.3         GGCCCTCCTCAGGACCTGTCTGTTCATCTCTGGTACGCAGGCCCCATGGAGCGGGCAGGG
NM_001258207.1      GGCCCTCCTCAGGACCTGTCTGTTCATCTCTGGTACGCAGGCCCCATGGAGCGGGCAGGG
NM_001258206.1      -GCCCTCCTCAGGACCTGTCTGTTCATCTCTGGTACGCAGGCCCCATGGAGCGGGCAGGG
                     ***********************************************************

HsCD00433454        GCAGAGAGCATCCTGGCCAACCGCTCGGACGGGACTTTCTTGGTGCGGCAGAGGGTGAAG
NM_005428.3         GCAGAGAGCATCCTGGCCAACCGCTCGGACGGGACTTTCTTGGTGCGGCAGAGGGTGAAG
NM_001258207.1      GCAGAGAGCATCCTGGCCAACCGCTCGGACGGGACTTTCTTGGTGCGGCAGAGGGTGAAG
NM_001258206.1      GCAGAGAGCATCCTGGCCAACCGCTCGGACGGGACTTTCTTGGTGCGGCAGAGGGTGAAG
                    ************************************************************

HsCD00433454        GATGCAGCAGAATTTGCCATCAGCATTAAATATAACGTCGAGGTCAAGCACATTAAAATC
NM_005428.3         GATGCAGCAGAATTTGCCATCAGCATTAAATATAACGTCGAGGTCAAGCACATTAAAATC
NM_001258207.1      GATGCAGCAGAATTTGCCATCAGCATTAAATATAACGTCGAGGTCAAGCACATTAAAATC
NM_001258206.1      GATGCAGCAGAATTTGCCATCAGCATTAAATATAACGTCGAGGTCAAGCACATTAAAATC
                    ************************************************************

HsCD00433454        ATGACAGCAGAAGGACTGTACCGGATCACAGAGAAAAAGGCTTTCCGGGGGCTTACGGAG
NM_005428.3         ATGACAGCAGAAGGACTGTACCGGATCACAGAGAAAAAGGCTTTCCGGGGGCTTACGGAG
NM_001258207.1      ATGACAGCAGAAGGACTGTACCGGATCACAGAGAAAAAGGCTTTCCGGGGGCTTACGGAG
NM_001258206.1      ATGACAGCAGAAGGACTGTACCGGATCACAGAGAAAAAGGCTTTCCGGGGGCTTACGGAG
                    ************************************************************

HsCD00433454        CTGGTGGAGTTTTACCAGCAGAACTCTCTAAAGGATTGCTTCAAGTCTCTGGACACCACC
NM_005428.3         CTGGTGGAGTTTTACCAGCAGAACTCTCTAAAGGATTGCTTCAAGTCTCTGGACACCACC
NM_001258207.1      CTGGTGGAGTTTTACCAGCAGAACTCTCTAAAGGATTGCTTCAAGTCTCTGGACACCACC
NM_001258206.1      CTGGTGGAGTTTTACCAGCAGAACTCTCTAAAGGATTGCTTCAAGTCTCTGGACACCACC
                    ************************************************************

HsCD00433454        TTGCAGTTCCCCTTCAAGGAGCCTGAAAAGAGAACCATCAGCAGGCCAGCAGTGGGAAGC
NM_005428.3         TTGCAGTTCCCCTTCAAGGAGCCTGAAAAGAGAACCATCAGCAGGCCAGCAGTGGGAAGC
NM_001258207.1      TTGCAGTTCCCCTTCAAGGAGCCTGAAAAGAGAACCATCAGCAGGCCAGCAGTGGGAAGC
NM_001258206.1      TTGCAGTTCCCCTTCAAGGAGCCTGAAAAGAGAACCATCAGCAGGCCAGCAGTGGGAAGC
                    ************************************************************

HsCD00433454        ACAAAGTATTTTGGCACAGCCAAAGCCCGCTATGACTTCTGCGCCCGAGACCGATCAGAG
NM_005428.3         ACAAAGTATTTTGGCACAGCCAAAGCCCGCTATGACTTCTGCGCCCGAGACCGATCAGAG
NM_001258207.1      ACAAAGTATTTTGGCACAGCCAAAGCCCGCTATGACTTCTGCGCCCGAGACCGATCAGAG
NM_001258206.1      ACAAAGTATTTTGGCACAGCCAAAGCCCGCTATGACTTCTGCGCCCGAGACCGATCAGAG
                    ************************************************************

HsCD00433454        CTGTCGCTCAAGGAGGGTGACATCATCAAGATCCTTAACAAGAAGGGACAGCAAGGCTGG
NM_005428.3         CTGTCGCTCAAGGAGGGTGACATCATCAAGATCCTTAACAAGAAGGGACAGCAAGGCTGG
NM_001258207.1      CTGTCGCTCAAGGAGGGTGACATCATCAAGATCCTTAACAAGAAGGGACAGCAAGGCTGG
NM_001258206.1      CTGTCGCTCAAGGAGGGTGACATCATCAAGATCCTTAACAAGAAGGGACAGCAAGGCTGG
                    ************************************************************

HsCD00433454        TGGCGAGGGGAGATCTATGGCCGGGTTGGCTGGTTCCCTGCCAACTACGTGGAGGAAGAT
NM_005428.3         TGGCGAGGGGAGATCTATGGCCGGGTTGGCTGGTTCCCTGCCAACTACGTGGAGGAAGAT
NM_001258207.1      TGGCGAGGGGAGATCTATGGCCGGGTTGGCTGGTTCCCTGCCAACTACGTGGAGGAAGAT
NM_001258206.1      TGGCGAGGGGAGATCTATGGCCGGGTTGGCTGGTTCCCTGCCAACTACGTGGAGGAAGAT
                    ************************************************************

HsCD00433454        TATTCTGAATACTGCTGA
NM_005428.3         TATTCTGAATACTGCTGA
NM_001258207.1      TATTCTGAATACTGCTGA
NM_001258206.1      TATTCTGAATACTGCTGA
                    ******************

Pathways

NCI : CXCR4-mediated signaling events
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : IL6-mediated signaling events
NCI : Regulation of RAC1 activity
NCI : Regulation of RhoA activity
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
Panther : B cell activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : PDGF signaling pathway
Panther : T cell activation
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : CD28 co-stimulation
Reactome : CD28 dependent Vav1 pathway
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FCERI mediated Ca+2 mobilization
Reactome : FCERI mediated MAPK activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : G alpha (12/13) signalling events
Reactome : GAB1 signalosome
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : NRAGE signals death through JNK
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of actin dynamics for phagocytic cup formation
Reactome : Regulation of signaling by CBL
Reactome : Rho GTPase cycle
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by Rho GTPases
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-6 signaling pathway
WikiPathway : Kit receptor signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : TCR Signaling Pathway

Clone

Cloning Information : 591492
Original Clone ID : VAV1_pDONR221_closed

Organism


TAX_ID : 9606
Species Specific ID: 7409

Genome

Chromosome : 19
Map Location : 19p13.2
Ensembl : ENSG00000141968