DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CG (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3CG
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Sequence             
Original Clone ID: PIK3CG_pDONR221_closed
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
Brianne Petritis
HsCD00433477

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3309nts         Open reading frame : 1 to 3309
Reference Sequence Alignment

ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
GAAGAGTGGCCGCTGGTGGACGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGTGCCCTTGCCAGATTT
CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
TCAGCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : PIK3CG
Symbol Nomenclature : PIK3CG
SYNONYM : PI3CG; PI3K; PI3Kgamma; PIK3; p110gamma; p120-PI3K
Designation : 1-phosphatidylinositol 3-kinase|PI3-kinase subunit gamma|phosphatidylinositol 3 kinase gamma, p110 gamma|phosphatidylinositol 3-kinase catalytic 110-kD gamma|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit gamma isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit gamma|phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma isoform|phosphoinositide-3-kinase gamma catalytic subunit|ptdIns-3-kinase subunit gamma|ptdIns-3-kinase subunit p110-gamma|serine/threonine protein kinase PIK3CG
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
GENEID : 5294
GenBank Accession : BC035683
HGNC : 8978
MIM : 601232
Vega : OTTHUMG00000157641
Target GenBank: BC035683

 

Reference Sequence Alignment

  

HsCD00433477        ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
NM_001282426.1      ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
NM_002649.3         ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
XM_005250443.1      ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
NM_001282427.1      ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
                    ************************************************************

HsCD00433477        CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
NM_001282426.1      CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
NM_002649.3         CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
XM_005250443.1      CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
NM_001282427.1      CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
                    ************************************************************

HsCD00433477        GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
NM_001282426.1      GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
NM_002649.3         GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
XM_005250443.1      GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
NM_001282427.1      GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
                    ************************************************************

HsCD00433477        GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
NM_001282426.1      GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
NM_002649.3         GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
XM_005250443.1      GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
NM_001282427.1      GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
                    ************************************************************

HsCD00433477        ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
NM_001282426.1      ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
NM_002649.3         ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
XM_005250443.1      ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
NM_001282427.1      ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
                    ************************************************************

HsCD00433477        CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
NM_001282426.1      CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
NM_002649.3         CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
XM_005250443.1      CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
NM_001282427.1      CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
                    ************************************************************

HsCD00433477        TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
NM_001282426.1      TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
NM_002649.3         TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
XM_005250443.1      TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
NM_001282427.1      TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
                    ************************************************************

HsCD00433477        CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
NM_001282426.1      CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
NM_002649.3         CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
XM_005250443.1      CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
NM_001282427.1      CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
                    ************************************************************

HsCD00433477        GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
NM_001282426.1      GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
NM_002649.3         GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
XM_005250443.1      GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
NM_001282427.1      GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
                    ************************************************************

HsCD00433477        GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
NM_001282426.1      GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
NM_002649.3         GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
XM_005250443.1      GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
NM_001282427.1      GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
                    ************************************************************

HsCD00433477        TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
NM_001282426.1      TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
NM_002649.3         TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
XM_005250443.1      TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
NM_001282427.1      TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
                    ************************************************************

HsCD00433477        TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
NM_001282426.1      TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
NM_002649.3         TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
XM_005250443.1      TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
NM_001282427.1      TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
                    ************************************************************

HsCD00433477        CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
NM_001282426.1      CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
NM_002649.3         CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
XM_005250443.1      CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
NM_001282427.1      CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
                    ************************************************************

HsCD00433477        ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
NM_001282426.1      ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
NM_002649.3         ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
XM_005250443.1      ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
NM_001282427.1      ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
                    ************************************************************

HsCD00433477        CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
NM_001282426.1      CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
NM_002649.3         CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
XM_005250443.1      CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
NM_001282427.1      CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
                    ************************************************************

HsCD00433477        GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
NM_001282426.1      GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
NM_002649.3         GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
XM_005250443.1      GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
NM_001282427.1      GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
                    ************************************************************

HsCD00433477        GAAGAGTGGCCGCTGGTGGACGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
NM_001282426.1      GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
NM_002649.3         GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
XM_005250443.1      GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
NM_001282427.1      GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
                    ***********.******** ***************************************

HsCD00433477        ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
NM_001282426.1      ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
NM_002649.3         ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
XM_005250443.1      ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
NM_001282427.1      ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
                    ************************************************************

HsCD00433477        TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
NM_001282426.1      TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
NM_002649.3         TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
XM_005250443.1      TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
NM_001282427.1      TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
                    ************************************************************

HsCD00433477        GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
NM_001282426.1      GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
NM_002649.3         GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
XM_005250443.1      GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
NM_001282427.1      GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
                    ************************************************************

HsCD00433477        CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
NM_001282426.1      CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
NM_002649.3         CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
XM_005250443.1      CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
NM_001282427.1      CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
                    ************************************************************

HsCD00433477        AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
NM_001282426.1      AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
NM_002649.3         AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
XM_005250443.1      AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
NM_001282427.1      AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
                    ************************************************************

HsCD00433477        CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
NM_001282426.1      CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
NM_002649.3         CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
XM_005250443.1      CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
NM_001282427.1      CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
                    ************************************************************

HsCD00433477        CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
NM_001282426.1      CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
NM_002649.3         CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
XM_005250443.1      CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
NM_001282427.1      CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
                    ************************************************************

HsCD00433477        GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
NM_001282426.1      GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
NM_002649.3         GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
XM_005250443.1      GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
NM_001282427.1      GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
                    ************************************************************

HsCD00433477        AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
NM_001282426.1      AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
NM_002649.3         AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
XM_005250443.1      AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
NM_001282427.1      AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
                    ************************************************************

HsCD00433477        GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
NM_001282426.1      GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
NM_002649.3         GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
XM_005250443.1      GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
NM_001282427.1      GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
                    ************************************************************

HsCD00433477        GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
NM_001282426.1      GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
NM_002649.3         GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
XM_005250443.1      GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
NM_001282427.1      GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
                    ************************************************************

HsCD00433477        ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
NM_001282426.1      ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
NM_002649.3         ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
XM_005250443.1      ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
NM_001282427.1      ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
                    ************************************************************

HsCD00433477        GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
NM_001282426.1      GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
NM_002649.3         GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
XM_005250443.1      GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
NM_001282427.1      GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
                    ************************************************************

HsCD00433477        CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
NM_001282426.1      CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
NM_002649.3         CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
XM_005250443.1      CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
NM_001282427.1      CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
                    ************************************************************

HsCD00433477        GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
NM_001282426.1      GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
NM_002649.3         GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
XM_005250443.1      GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
NM_001282427.1      GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
                    ************************************************************

HsCD00433477        AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
NM_001282426.1      AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
NM_002649.3         AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
XM_005250443.1      AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
NM_001282427.1      AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
                    ************************************************************

HsCD00433477        CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGTGCCCTTGCCAGATTT
NM_001282426.1      CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
NM_002649.3         CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
XM_005250443.1      CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
NM_001282427.1      CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
                    ******************************************** ***************

HsCD00433477        CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
NM_001282426.1      CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
NM_002649.3         CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
XM_005250443.1      CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
NM_001282427.1      CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
                    ************************************************************

HsCD00433477        AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
NM_001282426.1      AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
NM_002649.3         AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
XM_005250443.1      AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
NM_001282427.1      AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
                    ************************************************************

HsCD00433477        CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
NM_001282426.1      CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
NM_002649.3         CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
XM_005250443.1      CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
NM_001282427.1      CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
                    ************************************************************

HsCD00433477        ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
NM_001282426.1      ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
NM_002649.3         ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
XM_005250443.1      ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
NM_001282427.1      ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
                    ************************************************************

HsCD00433477        TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
NM_001282426.1      TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
NM_002649.3         TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
XM_005250443.1      TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
NM_001282427.1      TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
                    ************************************************************

HsCD00433477        GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
NM_001282426.1      GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
NM_002649.3         GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
XM_005250443.1      GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
NM_001282427.1      GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
                    ************************************************************

HsCD00433477        TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
NM_001282426.1      TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
NM_002649.3         TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
XM_005250443.1      TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
NM_001282427.1      TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
                    ************************************************************

HsCD00433477        ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
NM_001282426.1      ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
NM_002649.3         ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
XM_005250443.1      ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
NM_001282427.1      ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
                    ************************************************************

HsCD00433477        GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
NM_001282426.1      GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
NM_002649.3         GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
XM_005250443.1      GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
NM_001282427.1      GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
                    ************************************************************

HsCD00433477        GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
NM_001282426.1      GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
NM_002649.3         GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
XM_005250443.1      GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
NM_001282427.1      GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
                    ************************************************************

HsCD00433477        ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
NM_001282426.1      ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
NM_002649.3         ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
XM_005250443.1      ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
NM_001282427.1      ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
                    ************************************************************

HsCD00433477        GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
NM_001282426.1      GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
NM_002649.3         GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
XM_005250443.1      GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
NM_001282427.1      GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
                    ************************************************************

HsCD00433477        TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
NM_001282426.1      TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
NM_002649.3         TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
XM_005250443.1      TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
NM_001282427.1      TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
                    ************************************************************

HsCD00433477        GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
NM_001282426.1      GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
NM_002649.3         GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
XM_005250443.1      GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
NM_001282427.1      GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
                    ************************************************************

HsCD00433477        TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
NM_001282426.1      TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
NM_002649.3         TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
XM_005250443.1      TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
NM_001282427.1      TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
                    ************************************************************

HsCD00433477        GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
NM_001282426.1      GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
NM_002649.3         GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
XM_005250443.1      GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
NM_001282427.1      GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
                    ************************************************************

HsCD00433477        AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
NM_001282426.1      AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
NM_002649.3         AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
XM_005250443.1      AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
NM_001282427.1      AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
                    ************************************************************

HsCD00433477        CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
NM_001282426.1      CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
NM_002649.3         CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
XM_005250443.1      CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
NM_001282427.1      CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
                    ************************************************************

HsCD00433477        CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
NM_001282426.1      CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
NM_002649.3         CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
XM_005250443.1      CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
NM_001282427.1      CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
                    ************************************************************

HsCD00433477        GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
NM_001282426.1      GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
NM_002649.3         GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
XM_005250443.1      GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
NM_001282427.1      GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
                    ************************************************************

HsCD00433477        ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
NM_001282426.1      ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
NM_002649.3         ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
XM_005250443.1      ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
NM_001282427.1      ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
                    ************************************************************

HsCD00433477        TCAGCCTAG
NM_001282426.1      TCAGCCTAA
NM_002649.3         TCAGCCTAA
XM_005250443.1      TCAGCCTAA
NM_001282427.1      TCAGCCTAA
                    ********.

Pathways

NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : Class IB PI3K non-lipid kinase events
NCI : EPHA forward signaling
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Thromboxane A2 receptor signaling
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : G beta:gamma signalling through PI3Kgamma
Reactome : G-protein beta:gamma signalling
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : PI Metabolism
Reactome : Phospholipid metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Synthesis of PIPs at the plasma membrane
WikiPathway : AMPK signaling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : Focal Adhesion
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 591515
Original Clone ID : PIK3CG_pDONR221_closed

Organism


TAX_ID : 9606
Species Specific ID: 5294

Genome

Chromosome : 7
Map Location : 7q22.3
Ensembl : ENSG00000105851