DNASU Plasmid Repository • 480.965.5697 | Email

APH1B (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  APH1B
Gene Name:  APH1B gamma secretase subunit
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH176595.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00043418

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 774nts         Open reading frame : 1 to 774
Reference Sequence Alignment

ATGACTGCGGCCGTGTTCTTCGGCTGCGCCTTCATTGCCTTCGGGCCTGCGCTCGCCCTT
TATGTCTTCACCATCGCCACCGAGCCGTTGCGTATCATCTTCCTCATCGCCGGAGCTTTC
TTCTGGTTGGTGTCTCTACTGATTTCGTCCCTTGTTTGGTTCATGGCAAGAGTCATTATT
GACAACAAAGATGGACCAACACAGAAATATCTGCTGATCTTTGGAGCGTTTGTCTCTGTC
TATATCCAAGAAATGTTCCGATTTGCATATTATAAACTCTTAAAAAAAGCCAGTGAAGGT
TTGAAGAGTATAAACCCAGGTGAGACAGCACCCTCTATGCGACTGCTGGCCTATGTTTCT
GGCTTGGGCTTTGGAATCATGAGTGGAGTATTTTCCTTTGTGAATACCCTATCTGACTCC
TTGGGGCCAGGCACAGTGGGCATTCATGGAGATTCTCCTCAATTCTTCCTTTATTCAGCT
TTCATGACGCTGGTCATTATCTTGCTGCATGTATTCTGGGGCATTGTATTTTTTGATGGC
TGTGAGAAGAAAAAGTGGGGCATCCTCCTTATCGTTCTCCTGACCCACCTGCTGGTGTCA
GCCCAGACCTTCATAAGTTCTTATTATGGAATAAACCTGGCGTCAGCATTTATAATCCTG
GTGCTCATGGGCACCTGGGCATTCTTAGCTGCGGGAGGCAGCTGCCGAAGCCTGAAACTC
TGCCTGCTCTGCCAAGACAAGAACTTTCTTCTTTACAACCAGCGCTCCAGATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 790
Start on reference sequence 17
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : APH1B
Symbol Nomenclature : APH1B
SYNONYM : APH-1B; PRO1328; PSFL; TAAV688
Designation : anterior pharynx defective 1 homolog B|aph-1beta|gamma-secretase subunit APH-1B
Full Nomenclature : APH1B gamma secretase subunit
GENEID : 83464
Locus Tag : UNQ688/PRO1328
HGNC : 24080
MIM : 607630
Vega : OTTHUMG00000132863
Target GenBank: BC020905

 

Reference Sequence Alignment

  

HsCD00043418      ATGACTGCGGCCGTGTTCTTCGGCTGCGCCTTCATTGCCTTCGGGCCTGCGCTCGCCCTT
NM_031301.3       ATGACTGCGGCCGTGTTCTTCGGCTGCGCCTTCATTGCCTTCGGGCCTGCGCTCGCCCTT
                  ************************************************************

HsCD00043418      TATGTCTTCACCATCGCCACCGAGCCGTTGCGTATCATCTTCCTCATCGCCGGAGCTTTC
NM_031301.3       TATGTCTTCACCATCGCCACCGAGCCGTTGCGTATCATCTTCCTCATCGCCGGAGCTTTC
                  ************************************************************

HsCD00043418      TTCTGGTTGGTGTCTCTACTGATTTCGTCCCTTGTTTGGTTCATGGCAAGAGTCATTATT
NM_031301.3       TTCTGGTTGGTGTCTCTACTGATTTCGTCCCTTGTTTGGTTCATGGCAAGAGTCATTATT
                  ************************************************************

HsCD00043418      GACAACAAAGATGGACCAACACAGAAATATCTGCTGATCTTTGGAGCGTTTGTCTCTGTC
NM_031301.3       GACAACAAAGATGGACCAACACAGAAATATCTGCTGATCTTTGGAGCGTTTGTCTCTGTC
                  ************************************************************

HsCD00043418      TATATCCAAGAAATGTTCCGATTTGCATATTATAAACTCTTAAAAAAAGCCAGTGAAGGT
NM_031301.3       TATATCCAAGAAATGTTCCGATTTGCATATTATAAACTCTTAAAAAAAGCCAGTGAAGGT
                  ************************************************************

HsCD00043418      TTGAAGAGTATAAACCCAGGTGAGACAGCACCCTCTATGCGACTGCTGGCCTATGTTTCT
NM_031301.3       TTGAAGAGTATAAACCCAGGTGAGACAGCACCCTCTATGCGACTGCTGGCCTATGTTTCT
                  ************************************************************

HsCD00043418      GGCTTGGGCTTTGGAATCATGAGTGGAGTATTTTCCTTTGTGAATACCCTATCTGACTCC
NM_031301.3       GGCTTGGGCTTTGGAATCATGAGTGGAGTATTTTCCTTTGTGAATACCCTATCTGACTCC
                  ************************************************************

HsCD00043418      TTGGGGCCAGGCACAGTGGGCATTCATGGAGATTCTCCTCAATTCTTCCTTTATTCAGCT
NM_031301.3       TTGGGGCCAGGCACAGTGGGCATTCATGGAGATTCTCCTCAATTCTTCCTTTATTCAGCT
                  ************************************************************

HsCD00043418      TTCATGACGCTGGTCATTATCTTGCTGCATGTATTCTGGGGCATTGTATTTTTTGATGGC
NM_031301.3       TTCATGACGCTGGTCATTATCTTGCTGCATGTATTCTGGGGCATTGTATTTTTTGATGGC
                  ************************************************************

HsCD00043418      TGTGAGAAGAAAAAGTGGGGCATCCTCCTTATCGTTCTCCTGACCCACCTGCTGGTGTCA
NM_031301.3       TGTGAGAAGAAAAAGTGGGGCATCCTCCTTATCGTTCTCCTGACCCACCTGCTGGTGTCA
                  ************************************************************

HsCD00043418      GCCCAGACCTTCATAAGTTCTTATTATGGAATAAACCTGGCGTCAGCATTTATAATCCTG
NM_031301.3       GCCCAGACCTTCATAAGTTCTTATTATGGAATAAACCTGGCGTCAGCATTTATAATCCTG
                  ************************************************************

HsCD00043418      GTGCTCATGGGCACCTGGGCATTCTTAGCTGCGGGAGGCAGCTGCCGAAGCCTGAAACTC
NM_031301.3       GTGCTCATGGGCACCTGGGCATTCTTAGCTGCGGGAGGCAGCTGCCGAAGCCTGAAACTC
                  ************************************************************

HsCD00043418      TGCCTGCTCTGCCAAGACAAGAACTTTCTTCTTTACAACCAGCGCTCCAGATAG
NM_031301.3       TGCCTGCTCTGCCAAGACAAGAACTTTCTTCTTTACAACCAGCGCTCCAGATAA
                  *****************************************************.

Pathways

NCI : Notch signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Syndecan-3-mediated signaling events
NCI : p75(NTR)-mediated signaling
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Alzheimer disease-presenilin pathway
Panther : Notch signaling pathway
Reactome : A third proteolytic cleavage releases NICD
Reactome : Activated NOTCH1 Transmits Signal to the Nucleus
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 PEST Domain Mutants
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : NOTCH2 Activation and Transmission of Signal to the Nucleus
Reactome : NRIF signals cell death from the nucleus
Reactome : Nuclear signaling by ERBB4
Reactome : Regulated proteolysis of p75NTR
Reactome : Signal Transduction
Reactome : Signaling by ERBB4
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by NOTCH2
Reactome : Signaling by NOTCH3
Reactome : Signaling by NOTCH4
Reactome : Signalling by NGF
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : Notch Signaling Pathway

Protein

UniProt : Q564N3
UniProt : Q8WW43
HPRD : 06361

Clone

Cloning Information : 176595
HIP Master Clone ID : 151740
Original Clone ID : FLH176595.01X

Organism


TAX_ID : 9606
Species Specific ID: 83464

Genome

Chromosome : 15
Map Location : 15q22.2
Ensembl : ENSG00000138613

Reagents

Labome : APH1B-antibody