DNASU Plasmid Repository • 480.965.5697 | Email

NOD1 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NOD1
Gene Name:  nucleotide-binding oligomerization domain containing 1
Sequence             
Original Clone ID: N/A
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00434337

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2860nts         Open reading frame : 1 to 2860
Reference Sequence Alignment

ATGGAAGAGCAGGGCCACAGTGAGATGGAAATAATCCCATCAGAGTCTCACCCCCACATT
CAATTACTGAAAAGCAATCGGGAACTTCTGGTCACTCACATCCGCAATACTCAGTGTCTG
GTGGACAACTTGCTGAAGAATGACTACTTCTCGGCCGAAGATGCGGAGATTGTGTGTGCC
TGCCCCACCCAGCCTGACAAGGTCCGCAAAATTCTGGACCTGGTACAGAGCAAGGGCGAG
GAGGTGTCCGAGTTCTTCCTCTACTTGCTCCAGCAACTCGCAGATGCCTACGTGGACCTC
AGGCCTTGGCTGCTGGAGATCGGCTTCTCCCCTTCCCTGCTCACTCAGAGCAAAGTCGTG
GTCAACACTGACCCAGTGAGCAGGTATACCCAGCAGCTGCGACACCATCTGGGCCGTGAC
TCCAAGTTCGTGCTGTGCTATGCCCAGAAGGAGGAGCTGCTGCTGGAGGAGATCTACATG
GACACCATCATGGAGCTGGTTGGCTTCAGCAATGAGAGCCTGGGCAGCCTGAACAGCCTG
GCCTGCCTCCTGGACCACACCACCGGCATCCTCAATGAGCAGGGTGAGACCATCTTCATC
CTGGGTGATGCTGGGGTGGGCAAGTCCATGCTGCTACAGCGGCTGCAGAGCCTCTGGGCC
ACGGGCCGGCTAGACGCAGGGGTCAAATTCTTCTTCCACTTTCGCTGCCGCATGTTCAGC
TGCTTCAAGGAAAGTGACAGGCTGTGTCTGCAGGACCTGCTCTTCAAGCACTACTGCTAC
CCAGAGCGGGACCCCGAGGAGGTGTTTGCCTTCCTGCTGCGCTTCCCCCACGTGGCCCTC
TTCACCTTCGATGGCCTGGACGAGCTGCACTCGGACTTGGACCTGAGCCGTGTGCCTGAC
AGCTCCTGCCCCTGGGAGCCTGCCCACCCCCTGGTCTTGCTGGCCAACCTGCTCAGTGGG
AAGCTGCTCAAGGGGGCTAGCAAGCTGCTCACAGCCCGCACAGGCATCGAGGTCCCGCGC
CAGTTCCTGCGGAAGAAGGTGCTTCTCCGGGGCTTCTCCCCCAGCCACCTGCGCGCCTAT
GCCAGGAGGATGTTCCCCGAGCGGGCCCTGCAGGACCGCCTGCTGAGCCAGCTGGAGGCC
AACCCCAACCTCTGCAGCCTGTGCTCTGTGCCCCTCTTCTGCTGGATCATCTTCCGGTGC
TTCCAGCACTTCCGTGCTGCCTTTGAAGGCTCACCACAGCTGCCCGACTGCACGATGACC
CTGACAGATGTCTTCCTCCTGGTCACTGAGGTCCATCTGAACAGGATGCAGCCCAGCAGC
CTGGTGCAGCGGAACACACACAGCCCAGTGGAGACCCTCCACGCCGGCCGGGACACTCTG
TGCTCGCTGGGGCAGGTGGCCCACCGGGGCATGGAGAAGAGCCTCTTTGTCTTCACCCAG
GAGGAGGTGCAGGCCTCCGGGCTGCAGGAGAGAGACATGCAGCTGGGCTTCCTGCGGGCT
TTGCCGGAGCTGGGCCCCGGGGGTGACCAGCAGTCCTATGAGTTTTTCCACCTCACCCTC
CAGGCCTTCTTTACAGCCTTCTTCCTCGTGCTGGACGACAGGGTGGGCACTCAGGAGCTG
CTCAGGTTCTTCCAGGAGTGGATGCCCCCTGCGGGGGCAGCGACCACGTCCTGCTATCCT
CCCTTCCTCCCGTTCCAGTGCCTGCAGGGCAGTGGTCCGGCGCGGGAAGACCTCTTCAAG
AACAAGGATCACTTCCAGTTCACCAACCTCTTCCTGTGCGGGCTGTTGTCCAAAGCCAAA
CAGAAACTCCTGCGGCATCTGGTGCCCGCGGCAGCCCTGAGGAGAAAGCGCAAGGCCCTG
TGGGCACACCTGTTTTCCAGCCTGCGGGGCTACCTGAAGAGCCTGCCCCGCGTTCAGGTC
GAAAGCTTCAACCAGGTGCAGGCCATGCCCACGTTCATCTGGATGCTGCGCTGCATCTAC
GAGACACAGAGCCAGAAGGTGGGGCAGCTGGCGGCCAGGGGCATCTGCGCCAACTACCTC
AAGCTGACCTACTGCAACGCCTGCTCGGCCGACTGCAGCGCCCTCTCCTTCGTCCTGCAT
CACTTCCCCAAGCGGCTGGCCCTAGACCTAGACAACAACAATCTCAACGACTACGGCGTG
CGGGAGCTGCAGCCCTGCTTCAGCCGCCTCACTGTTCTCAGACTCAGCGTAAACCAGATC
ACTGACGGTGGGGTAAAGGTGCTAAGCGAAGAGCTGACCAAATACAAAATTGTGACCTAT
TTGGGTTTATACAACAACCAGATCACCGATGTCGGAGCCAGGTACGTCACCAAAATCCTG
GATGAATGCAAAGGCCTCACGCATCTTAAACTGGGAAAAAACAAAATAACAAGTGAAGGA
GGGAAGTATCTCGCCCTGGCTGTGAAGAACAGCAAATCAATCTCTGAGGTTGGGATGTGG
GGCAATCAAGTTGGGGATGAAGGAGCAAAAGCCTTCGCAGAGGCTCTGCGGAACCACCCC
AGCTTGACCACCCTGAGTCTTGCGTCCAACGGCATCTCCACAGAAGGAGGAAAGAGCCTT
GCGAGGGCCCTGCAGCAGAACACGTCTCTAGAAATACTGTGGCTGACCCAAAATGAACTC
AACGATGAAGTGGCAGAGAGTTTGGCAGAAATGTTGAAAGTCAACCAGACGTTAAAGCAT
TTATGGCTTATCCAGAATCAGATCACAGCTAAGGGGACTGCCCAGCTGGCAGATGCGTTA
CAGAGCAACACTGGCATAACAGAGATTTGCCTAAATGGAAACCTGATAAAACCAGAGGAG
GCCAAAGTCTATGAAGATGAGAAGCGGATTATCTGTTTC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NOD1
Symbol Nomenclature : NOD1
SYNONYM : CARD4; CLR7.1; NLRC1
Designation : NLR family, CARD domain containing 1|caspase recruitment domain family, member 4|caspase recruitment domain-containing protein 4|nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1|nucleotide-binding oligomerization domain-containing protein 1
Full Nomenclature : nucleotide-binding oligomerization domain containing 1
GENEID : 10392
HGNC : 16390
MIM : 605980
Vega : OTTHUMG00000023923
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00434337        ATGGAAGAGCAGGGCCACAGTGAGATGGAAATAATCCCATCAGAGTCTCACCCCCACATT
XM_005249574.1      ATGGAAGAGCAGGGCCACAGTGAGATGGAAATAATCCCATCAGAGTCTCACCCCCACATT
XM_005249572.1      ATGGAAGAGCAGGGCCACAGTGAGATGGAAATAATCCCATCAGAGTCTCACCCCCACATT
NM_006092.2         ATGGAAGAGCAGGGCCACAGTGAGATGGAAATAATCCCATCAGAGTCTCACCCCCACATT
XM_005249573.1      ATGGAAGAGCAGGGCCACAGTGAGATGGAAATAATCCCATCAGAGTCTCACCCCCACATT
XM_005249568.1      ATGGAAGAGCAGGGCCACAGTGAGATGGAAATAATCCCATCAGAGTCTCACCCCCACATT
                    ************************************************************

HsCD00434337        CAATTACTGAAAAGCAATCGGGAACTTCTGGTCACTCACATCCGCAATACTCAGTGTCTG
XM_005249574.1      CAATTACTGAAAAGCAATCGGGAACTTCTGGTCACTCACATCCGCAATACTCAGTGTCTG
XM_005249572.1      CAATTACTGAAAAGCAATCGGGAACTTCTGGTCACTCACATCCGCAATACTCAGTGTCTG
NM_006092.2         CAATTACTGAAAAGCAATCGGGAACTTCTGGTCACTCACATCCGCAATACTCAGTGTCTG
XM_005249573.1      CAATTACTGAAAAGCAATCGGGAACTTCTGGTCACTCACATCCGCAATACTCAGTGTCTG
XM_005249568.1      CAATTACTGAAAAGCAATCGGGAACTTCTGGTCACTCACATCCGCAATACTCAGTGTCTG
                    ************************************************************

HsCD00434337        GTGGACAACTTGCTGAAGAATGACTACTTCTCGGCCGAAGATGCGGAGATTGTGTGTGCC
XM_005249574.1      GTGGACAACTTGCTGAAGAATGACTACTTCTCGGCCGAAGATGCGGAGATTGTGTGTGCC
XM_005249572.1      GTGGACAACTTGCTGAAGAATGACTACTTCTCGGCCGAAGATGCGGAGATTGTGTGTGCC
NM_006092.2         GTGGACAACTTGCTGAAGAATGACTACTTCTCGGCCGAAGATGCGGAGATTGTGTGTGCC
XM_005249573.1      GTGGACAACTTGCTGAAGAATGACTACTTCTCGGCCGAAGATGCGGAGATTGTGTGTGCC
XM_005249568.1      GTGGACAACTTGCTGAAGAATGACTACTTCTCGGCCGAAGATGCGGAGATTGTGTGTGCC
                    ************************************************************

HsCD00434337        TGCCCCACCCAGCCTGACAAGGTCCGCAAAATTCTGGACCTGGTACAGAGCAAGGGCGAG
XM_005249574.1      TGCCCCACCCAGCCTGACAAGGTCCGCAAAATTCTGGACCTGGTACAGAGCAAGGGCGAG
XM_005249572.1      TGCCCCACCCAGCCTGACAAGGTCCGCAAAATTCTGGACCTGGTACAGAGCAAGGGCGAG
NM_006092.2         TGCCCCACCCAGCCTGACAAGGTCCGCAAAATTCTGGACCTGGTACAGAGCAAGGGCGAG
XM_005249573.1      TGCCCCACCCAGCCTGACAAGGTCCGCAAAATTCTGGACCTGGTACAGAGCAAGGGCGAG
XM_005249568.1      TGCCCCACCCAGCCTGACAAGGTCCGCAAAATTCTGGACCTGGTACAGAGCAAGGGCGAG
                    ************************************************************

HsCD00434337        GAGGTGTCCGAGTTCTTCCTCTACTTGCTCCAGCAACTCGCAGATGCCTACGTGGACCTC
XM_005249574.1      GAGGTGTCCGAGTTCTTCCTCTACTTGCTCCAGCAACTCGCAGATGCCTACGTGGACCTC
XM_005249572.1      GAGGTGTCCGAGTTCTTCCTCTACTTGCTCCAGCAACTCGCAGATGCCTACGTGGACCTC
NM_006092.2         GAGGTGTCCGAGTTCTTCCTCTACTTGCTCCAGCAACTCGCAGATGCCTACGTGGACCTC
XM_005249573.1      GAGGTGTCCGAGTTCTTCCTCTACTTGCTCCAGCAACTCGCAGATGCCTACGTGGACCTC
XM_005249568.1      GAGGTGTCCGAGTTCTTCCTCTACTTGCTCCAGCAACTCGCAGATGCCTACGTGGACCTC
                    ************************************************************

HsCD00434337        AGGCCTTGGCTGCTGGAGATCGGCTTCTCCCCTTCCCTGCTCACTCAGAGCAAAGTCGTG
XM_005249574.1      AGGCCTTGGCTGCTGGAGATCGGCTTCTCCCCTTCCCTGCTCACTCAGAGCAAAGTCGTG
XM_005249572.1      AGGCCTTGGCTGCTGGAGATCGGCTTCTCCCCTTCCCTGCTCACTCAGAGCAAAGTCGTG
NM_006092.2         AGGCCTTGGCTGCTGGAGATCGGCTTCTCCCCTTCCCTGCTCACTCAGAGCAAAGTCGTG
XM_005249573.1      AGGCCTTGGCTGCTGGAGATCGGCTTCTCCCCTTCCCTGCTCACTCAGAGCAAAGTCGTG
XM_005249568.1      AGGCCTTGGCTGCTGGAGATCGGCTTCTCCCCTTCCCTGCTCACTCAGAGCAAAGTCGTG
                    ************************************************************

HsCD00434337        GTCAACACTGACCCAGTGAGCAGGTATACCCAGCAGCTGCGACACCATCTGGGCCGTGAC
XM_005249574.1      GTCAACACTGACCCAGTGAGCAGGTATACCCAGCAGCTGCGACACCATCTGGGCCGTGAC
XM_005249572.1      GTCAACACTGACCCAGTGAGCAGGTATACCCAGCAGCTGCGACACCATCTGGGCCGTGAC
NM_006092.2         GTCAACACTGACCCAGTGAGCAGGTATACCCAGCAGCTGCGACACCATCTGGGCCGTGAC
XM_005249573.1      GTCAACACTGACCCAGTGAGCAGGTATACCCAGCAGCTGCGACACCATCTGGGCCGTGAC
XM_005249568.1      GTCAACACTGACCCAGTGAGCAGGTATACCCAGCAGCTGCGACACCATCTGGGCCGTGAC
                    ************************************************************

HsCD00434337        TCCAAGTTCGTGCTGTGCTATGCCCAGAAGGAGGAGCTGCTGCTGGAGGAGATCTACATG
XM_005249574.1      TCCAAGTTCGTGCTGTGCTATGCCCAGAAGGAGGAGCTGCTGCTGGAGGAGATCTACATG
XM_005249572.1      TCCAAGTTCGTGCTGTGCTATGCCCAGAAGGAGGAGCTGCTGCTGGAGGAGATCTACATG
NM_006092.2         TCCAAGTTCGTGCTGTGCTATGCCCAGAAGGAGGAGCTGCTGCTGGAGGAGATCTACATG
XM_005249573.1      TCCAAGTTCGTGCTGTGCTATGCCCAGAAGGAGGAGCTGCTGCTGGAGGAGATCTACATG
XM_005249568.1      TCCAAGTTCGTGCTGTGCTATGCCCAGAAGGAGGAGCTGCTGCTGGAGGAGATCTACATG
                    ************************************************************

HsCD00434337        GACACCATCATGGAGCTGGTTGGCTTCAGCAATGAGAGCCTGGGCAGCCTGAACAGCCTG
XM_005249574.1      GACACCATCATGGAGCTGGTTGGCTTCAGCAATGAGAGCCTGGGCAGCCTGAACAGCCTG
XM_005249572.1      GACACCATCATGGAGCTGGTTGGCTTCAGCAATGAGAGCCTGGGCAGCCTGAACAGCCTG
NM_006092.2         GACACCATCATGGAGCTGGTTGGCTTCAGCAATGAGAGCCTGGGCAGCCTGAACAGCCTG
XM_005249573.1      GACACCATCATGGAGCTGGTTGGCTTCAGCAATGAGAGCCTGGGCAGCCTGAACAGCCTG
XM_005249568.1      GACACCATCATGGAGCTGGTTGGCTTCAGCAATGAGAGCCTGGGCAGCCTGAACAGCCTG
                    ************************************************************

HsCD00434337        GCCTGCCTCCTGGACCACACCACCGGCATCCTCAATGAGCAGGGTGAGACCATCTTCATC
XM_005249574.1      GCCTGCCTCCTGGACCACACCACCGGCATCCTCAATGAGCAGGGTGAGACCATCTTCATC
XM_005249572.1      GCCTGCCTCCTGGACCACACCACCGGCATCCTCAATGAGCAGGGTGAGACCATCTTCATC
NM_006092.2         GCCTGCCTCCTGGACCACACCACCGGCATCCTCAATGAGCAGGGTGAGACCATCTTCATC
XM_005249573.1      GCCTGCCTCCTGGACCACACCACCGGCATCCTCAATGAGCAGGGTGAGACCATCTTCATC
XM_005249568.1      GCCTGCCTCCTGGACCACACCACCGGCATCCTCAATGAGCAGGGTGAGACCATCTTCATC
                    ************************************************************

HsCD00434337        CTGGGTGATGCTGGGGTGGGCAAGTCCATGCTGCTACAGCGGCTGCAGAGCCTCTGGGCC
XM_005249574.1      CTGGGTGATGCTGGGGTGGGCAAGTCCATGCTGCTACAGCGGCTGCAGAGCCTCTGGGCC
XM_005249572.1      CTGGGTGATGCTGGGGTGGGCAAGTCCATGCTGCTACAGCGGCTGCAGAGCCTCTGGGCC
NM_006092.2         CTGGGTGATGCTGGGGTGGGCAAGTCCATGCTGCTACAGCGGCTGCAGAGCCTCTGGGCC
XM_005249573.1      CTGGGTGATGCTGGGGTGGGCAAGTCCATGCTGCTACAGCGGCTGCAGAGCCTCTGGGCC
XM_005249568.1      CTGGGTGATGCTGGGGTGGGCAAGTCCATGCTGCTACAGCGGCTGCAGAGCCTCTGGGCC
                    ************************************************************

HsCD00434337        ACGGGCCGGCTAGACGCAGGGGTCAAATTCTTCTTCCACTTTCGCTGCCGCATGTTCAGC
XM_005249574.1      ACGGGCCGGCTAGACGCAGGGGTCAAATTCTTCTTCCACTTTCGCTGCCGCATGTTCAGC
XM_005249572.1      ACGGGCCGGCTAGACGCAGGGGTCAAATTCTTCTTCCACTTTCGCTGCCGCATGTTCAGC
NM_006092.2         ACGGGCCGGCTAGACGCAGGGGTCAAATTCTTCTTCCACTTTCGCTGCCGCATGTTCAGC
XM_005249573.1      ACGGGCCGGCTAGACGCAGGGGTCAAATTCTTCTTCCACTTTCGCTGCCGCATGTTCAGC
XM_005249568.1      ACGGGCCGGCTAGACGCAGGGGTCAAATTCTTCTTCCACTTTCGCTGCCGCATGTTCAGC
                    ************************************************************

HsCD00434337        TGCTTCAAGGAAAGTGACAGGCTGTGTCTGCAGGACCTGCTCTTCAAGCACTACTGCTAC
XM_005249574.1      TGCTTCAAGGAAAGTGACAGGCTGTGTCTGCAGGACCTGCTCTTCAAGCACTACTGCTAC
XM_005249572.1      TGCTTCAAGGAAAGTGACAGGCTGTGTCTGCAGGACCTGCTCTTCAAGCACTACTGCTAC
NM_006092.2         TGCTTCAAGGAAAGTGACAGGCTGTGTCTGCAGGACCTGCTCTTCAAGCACTACTGCTAC
XM_005249573.1      TGCTTCAAGGAAAGTGACAGGCTGTGTCTGCAGGACCTGCTCTTCAAGCACTACTGCTAC
XM_005249568.1      TGCTTCAAGGAAAGTGACAGGCTGTGTCTGCAGGACCTGCTCTTCAAGCACTACTGCTAC
                    ************************************************************

HsCD00434337        CCAGAGCGGGACCCCGAGGAGGTGTTTGCCTTCCTGCTGCGCTTCCCCCACGTGGCCCTC
XM_005249574.1      CCAGAGCGGGACCCCGAGGAGGTGTTTGCCTTCCTGCTGCGCTTCCCCCACGTGGCCCTC
XM_005249572.1      CCAGAGCGGGACCCCGAGGAGGTGTTTGCCTTCCTGCTGCGCTTCCCCCACGTGGCCCTC
NM_006092.2         CCAGAGCGGGACCCCGAGGAGGTGTTTGCCTTCCTGCTGCGCTTCCCCCACGTGGCCCTC
XM_005249573.1      CCAGAGCGGGACCCCGAGGAGGTGTTTGCCTTCCTGCTGCGCTTCCCCCACGTGGCCCTC
XM_005249568.1      CCAGAGCGGGACCCCGAGGAGGTGTTTGCCTTCCTGCTGCGCTTCCCCCACGTGGCCCTC
                    ************************************************************

HsCD00434337        TTCACCTTCGATGGCCTGGACGAGCTGCACTCGGACTTGGACCTGAGCCGTGTGCCTGAC
XM_005249574.1      TTCACCTTCGATGGCCTGGACGAGCTGCACTCGGACTTGGACCTGAGCCGCGTGCCTGAC
XM_005249572.1      TTCACCTTCGATGGCCTGGACGAGCTGCACTCGGACTTGGACCTGAGCCGCGTGCCTGAC
NM_006092.2         TTCACCTTCGATGGCCTGGACGAGCTGCACTCGGACTTGGACCTGAGCCGCGTGCCTGAC
XM_005249573.1      TTCACCTTCGATGGCCTGGACGAGCTGCACTCGGACTTGGACCTGAGCCGCGTGCCTGAC
XM_005249568.1      TTCACCTTCGATGGCCTGGACGAGCTGCACTCGGACTTGGACCTGAGCCGCGTGCCTGAC
                    ************************************************** *********

HsCD00434337        AGCTCCTGCCCCTGGGAGCCTGCCCACCCCCTGGTCTTGCTGGCCAACCTGCTCAGTGGG
XM_005249574.1      AGCTCCTGCCCCTGGGAGCCTGCCCACCCCCTGGTCTTGCTGGCCAACCTGCTCAGTGGG
XM_005249572.1      AGCTCCTGCCCCTGGGAGCCTGCCCACCCCCTGGTCTTGCTGGCCAACCTGCTCAGTGGG
NM_006092.2         AGCTCCTGCCCCTGGGAGCCTGCCCACCCCCTGGTCTTGCTGGCCAACCTGCTCAGTGGG
XM_005249573.1      AGCTCCTGCCCCTGGGAGCCTGCCCACCCCCTGGTCTTGCTGGCCAACCTGCTCAGTGGG
XM_005249568.1      AGCTCCTGCCCCTGGGAGCCTGCCCACCCCCTGGTCTTGCTGGCCAACCTGCTCAGTGGG
                    ************************************************************

HsCD00434337        AAGCTGCTCAAGGGGGCTAGCAAGCTGCTCACAGCCCGCACAGGCATCGAGGTCCCGCGC
XM_005249574.1      AAGCTGCTCAAGGGGGCTAGCAAGCTGCTCACAGCCCGCACAGGCATCGAGGTCCCGCGC
XM_005249572.1      AAGCTGCTCAAGGGGGCTAGCAAGCTGCTCACAGCCCGCACAGGCATCGAGGTCCCGCGC
NM_006092.2         AAGCTGCTCAAGGGGGCTAGCAAGCTGCTCACAGCCCGCACAGGCATCGAGGTCCCGCGC
XM_005249573.1      AAGCTGCTCAAGGGGGCTAGCAAGCTGCTCACAGCCCGCACAGGCATCGAGGTCCCGCGC
XM_005249568.1      AAGCTGCTCAAGGGGGCTAGCAAGCTGCTCACAGCCCGCACAGGCATCGAGGTCCCGCGC
                    ************************************************************

HsCD00434337        CAGTTCCTGCGGAAGAAGGTGCTTCTCCGGGGCTTCTCCCCCAGCCACCTGCGCGCCTAT
XM_005249574.1      CAGTTCCTGCGGAAGAAGGTGCTTCTCCGGGGCTTCTCCCCCAGCCACCTGCGCGCCTAT
XM_005249572.1      CAGTTCCTGCGGAAGAAGGTGCTTCTCCGGGGCTTCTCCCCCAGCCACCTGCGCGCCTAT
NM_006092.2         CAGTTCCTGCGGAAGAAGGTGCTTCTCCGGGGCTTCTCCCCCAGCCACCTGCGCGCCTAT
XM_005249573.1      CAGTTCCTGCGGAAGAAGGTGCTTCTCCGGGGCTTCTCCCCCAGCCACCTGCGCGCCTAT
XM_005249568.1      CAGTTCCTGCGGAAGAAGGTGCTTCTCCGGGGCTTCTCCCCCAGCCACCTGCGCGCCTAT
                    ************************************************************

HsCD00434337        GCCAGGAGGATGTTCCCCGAGCGGGCCCTGCAGGACCGCCTGCTGAGCCAGCTGGAGGCC
XM_005249574.1      GCCAGGAGGATGTTCCCCGAGCGGGCCCTGCAGGACCGCCTGCTGAGCCAGCTGGAGGCC
XM_005249572.1      GCCAGGAGGATGTTCCCCGAGCGGGCCCTGCAGGACCGCCTGCTGAGCCAGCTGGAGGCC
NM_006092.2         GCCAGGAGGATGTTCCCCGAGCGGGCCCTGCAGGACCGCCTGCTGAGCCAGCTGGAGGCC
XM_005249573.1      GCCAGGAGGATGTTCCCCGAGCGGGCCCTGCAGGACCGCCTGCTGAGCCAGCTGGAGGCC
XM_005249568.1      GCCAGGAGGATGTTCCCCGAGCGGGCCCTGCAGGACCGCCTGCTGAGCCAGCTGGAGGCC
                    ************************************************************

HsCD00434337        AACCCCAACCTCTGCAGCCTGTGCTCTGTGCCCCTCTTCTGCTGGATCATCTTCCGGTGC
XM_005249574.1      AACCCCAACCTCTGCAGCCTGTGCTCTGTGCCCCTCTTCTGCTGGATCATCTTCCGGTGC
XM_005249572.1      AACCCCAACCTCTGCAGCCTGTGCTCTGTGCCCCTCTTCTGCTGGATCATCTTCCGGTGC
NM_006092.2         AACCCCAACCTCTGCAGCCTGTGCTCTGTGCCCCTCTTCTGCTGGATCATCTTCCGGTGC
XM_005249573.1      AACCCCAACCTCTGCAGCCTGTGCTCTGTGCCCCTCTTCTGCTGGATCATCTTCCGGTGC
XM_005249568.1      AACCCCAACCTCTGCAGCCTGTGCTCTGTGCCCCTCTTCTGCTGGATCATCTTCCGGTGC
                    ************************************************************

HsCD00434337        TTCCAGCACTTCCGTGCTGCCTTTGAAGGCTCACCACAGCTGCCCGACTGCACGATGACC
XM_005249574.1      TTCCAGCACTTCCGTGCTGCCTTTGAAGGCTCACCACAGCTGCCCGACTGCACGATGACC
XM_005249572.1      TTCCAGCACTTCCGTGCTGCCTTTGAAGGCTCACCACAGCTGCCCGACTGCACGATGACC
NM_006092.2         TTCCAGCACTTCCGTGCTGCCTTTGAAGGCTCACCACAGCTGCCCGACTGCACGATGACC
XM_005249573.1      TTCCAGCACTTCCGTGCTGCCTTTGAAGGCTCACCACAGCTGCCCGACTGCACGATGACC
XM_005249568.1      TTCCAGCACTTCCGTGCTGCCTTTGAAGGCTCACCACAGCTGCCCGACTGCACGATGACC
                    ************************************************************

HsCD00434337        CTGACAGATGTCTTCCTCCTGGTCACTGAGGTCCATCTGAACAGGATGCAGCCCAGCAGC
XM_005249574.1      CTGACAGATGTCTTCCTCCTGGTCACTGAGGTCCATCTGAACAGGATGCAGCCCAGCAGC
XM_005249572.1      CTGACAGATGTCTTCCTCCTGGTCACTGAGGTCCATCTGAACAGGATGCAGCCCAGCAGC
NM_006092.2         CTGACAGATGTCTTCCTCCTGGTCACTGAGGTCCATCTGAACAGGATGCAGCCCAGCAGC
XM_005249573.1      CTGACAGATGTCTTCCTCCTGGTCACTGAGGTCCATCTGAACAGGATGCAGCCCAGCAGC
XM_005249568.1      CTGACAGATGTCTTCCTCCTGGTCACTGAGGTCCATCTGAACAGGATGCAGCCCAGCAGC
                    ************************************************************

HsCD00434337        CTGGTGCAGCGGAACACACACAGCCCAGTGGAGACCCTCCACGCCGGCCGGGACACTCTG
XM_005249574.1      CTGGTGCAGCGGAACACACGCAGCCCAGTGGAGACCCTCCACGCCGGCCGGGACACTCTG
XM_005249572.1      CTGGTGCAGCGGAACACACGCAGCCCAGTGGAGACCCTCCACGCCGGCCGGGACACTCTG
NM_006092.2         CTGGTGCAGCGGAACACACGCAGCCCAGTGGAGACCCTCCACGCCGGCCGGGACACTCTG
XM_005249573.1      CTGGTGCAGCGGAACACACGCAGCCCAGTGGAGACCCTCCACGCCGGCCGGGACACTCTG
XM_005249568.1      CTGGTGCAGCGGAACACACGCAGCCCAGTGGAGACCCTCCACGCCGGCCGGGACACTCTG
                    *******************.****************************************

HsCD00434337        TGCTCGCTGGGGCAGGTGGCCCACCGGGGCATGGAGAAGAGCCTCTTTGTCTTCACCCAG
XM_005249574.1      TGCTCGCTGGGGCAGGTGGCCCACCGGGGCATGGAGAAGAGCCTCTTTGTCTTCACCCAG
XM_005249572.1      TGCTCGCTGGGGCAGGTGGCCCACCGGGGCATGGAGAAGAGCCTCTTTGTCTTCACCCAG
NM_006092.2         TGCTCGCTGGGGCAGGTGGCCCACCGGGGCATGGAGAAGAGCCTCTTTGTCTTCACCCAG
XM_005249573.1      TGCTCGCTGGGGCAGGTGGCCCACCGGGGCATGGAGAAGAGCCTCTTTGTCTTCACCCAG
XM_005249568.1      TGCTCGCTGGGGCAGGTGGCCCACCGGGGCATGGAGAAGAGCCTCTTTGTCTTCACCCAG
                    ************************************************************

HsCD00434337        GAGGAGGTGCAGGCCTCCGGGCTGCAGGAGAGAGACATGCAGCTGGGCTTCCTGCGGGCT
XM_005249574.1      GAGGAGGTGCAGGCCTCCGGGCTGCAGGAGAGAGACATGCAGCTGGGCTTCCTGCGGGCT
XM_005249572.1      GAGGAGGTGCAGGCCTCCGGGCTGCAGGAGAGAGACATGCAGCTGGGCTTCCTGCGGGCT
NM_006092.2         GAGGAGGTGCAGGCCTCCGGGCTGCAGGAGAGAGACATGCAGCTGGGCTTCCTGCGGGCT
XM_005249573.1      GAGGAGGTGCAGGCCTCCGGGCTGCAGGAGAGAGACATGCAGCTGGGCTTCCTGCGGGCT
XM_005249568.1      GAGGAGGTGCAGGCCTCCGGGCTGCAGGAGAGAGACATGCAGCTGGGCTTCCTGCGGGCT
                    ************************************************************

HsCD00434337        TTGCCGGAGCTGGGCCCCGGGGGTGACCAGCAGTCCTATGAGTTTTTCCACCTCACCCTC
XM_005249574.1      TTGCCGGAGCTGGGCCCCGGGGGTGACCAGCAGTCCTATGAGTTTTTCCACCTCACCCTC
XM_005249572.1      TTGCCGGAGCTGGGCCCCGGGGGTGACCAGCAGTCCTATGAGTTTTTCCACCTCACCCTC
NM_006092.2         TTGCCGGAGCTGGGCCCCGGGGGTGACCAGCAGTCCTATGAGTTTTTCCACCTCACCCTC
XM_005249573.1      TTGCCGGAGCTGGGCCCCGGGGGTGACCAGCAGTCCTATGAGTTTTTCCACCTCACCCTC
XM_005249568.1      TTGCCGGAGCTGGGCCCCGGGGGTGACCAGCAGTCCTATGAGTTTTTCCACCTCACCCTC
                    ************************************************************

HsCD00434337        CAGGCCTTCTTTACAGCCTTCTTCCTCGTGCTGGACGACAGGGTGGGCACTCAGGAGCTG
XM_005249574.1      CAGGCCTTCTTTACAGCCTTCTTCCTCGTGCTGGACGACAGGGTGGGCACTCAGGAGCTG
XM_005249572.1      CAGGCCTTCTTTACAGCCTTCTTCCTCGTGCTGGACGACAGGGTGGGCACTCAGGAGCTG
NM_006092.2         CAGGCCTTCTTTACAGCCTTCTTCCTCGTGCTGGACGACAGGGTGGGCACTCAGGAGCTG
XM_005249573.1      CAGGCCTTCTTTACAGCCTTCTTCCTCGTGCTGGACGACAGGGTGGGCACTCAGGAGCTG
XM_005249568.1      CAGGCCTTCTTTACAGCCTTCTTCCTCGTGCTGGACGACAGGGTGGGCACTCAGGAGCTG
                    ************************************************************

HsCD00434337        CTCAGGTTCTTCCAGGAGTGGATGCCCCCTGCGGGGGCAGCGACCACGTCCTGCTATCCT
XM_005249574.1      CTCAGGTTCTTCCAGGAGTGGATGCCCCCTGCGGGGGCAGCGACCACGTCCTGCTATCCT
XM_005249572.1      CTCAGGTTCTTCCAGGAGTGGATGCCCCCTGCGGGGGCAGCGACCACGTCCTGCTATCCT
NM_006092.2         CTCAGGTTCTTCCAGGAGTGGATGCCCCCTGCGGGGGCAGCGACCACGTCCTGCTATCCT
XM_005249573.1      CTCAGGTTCTTCCAGGAGTGGATGCCCCCTGCGGGGGCAGCGACCACGTCCTGCTATCCT
XM_005249568.1      CTCAGGTTCTTCCAGGAGTGGATGCCCCCTGCGGGGGCAGCGACCACGTCCTGCTATCCT
                    ************************************************************

HsCD00434337        CCCTTCCTCCCGTTCCAGTGCCTGCAGGGCAGTGGTCCGGCGCGGGAAGACCTCTTCAAG
XM_005249574.1      CCCTTCCTCCCGTTCCAGTGCCTGCAGGGCAGTGGTCCGGCGCGGGAAGACCTCTTCAAG
XM_005249572.1      CCCTTCCTCCCGTTCCAGTGCCTGCAGGGCAGTGGTCCGGCGCGGGAAGACCTCTTCAAG
NM_006092.2         CCCTTCCTCCCGTTCCAGTGCCTGCAGGGCAGTGGTCCGGCGCGGGAAGACCTCTTCAAG
XM_005249573.1      CCCTTCCTCCCGTTCCAGTGCCTGCAGGGCAGTGGTCCGGCGCGGGAAGACCTCTTCAAG
XM_005249568.1      CCCTTCCTCCCGTTCCAGTGCCTGCAGGGCAGTGGTCCGGCGCGGGAAGACCTCTTCAAG
                    ************************************************************

HsCD00434337        AACAAGGATCACTTCCAGTTCACCAACCTCTTCCTGTGCGGGCTGTTGTCCAAAGCCAAA
XM_005249574.1      AACAAGGATCACTTCCAGTTCACCAACCTCTTCCTGTGCGGGCTGTTGTCCAAAGCCAAA
XM_005249572.1      AACAAGGATCACTTCCAGTTCACCAACCTCTTCCTGTGCGGGCTGTTGTCCAAAGCCAAA
NM_006092.2         AACAAGGATCACTTCCAGTTCACCAACCTCTTCCTGTGCGGGCTGTTGTCCAAAGCCAAA
XM_005249573.1      AACAAGGATCACTTCCAGTTCACCAACCTCTTCCTGTGCGGGCTGTTGTCCAAAGCCAAA
XM_005249568.1      AACAAGGATCACTTCCAGTTCACCAACCTCTTCCTGTGCGGGCTGTTGTCCAAAGCCAAA
                    ************************************************************

HsCD00434337        CAGAAACTCCTGCGGCATCTGGTGCCCGCGGCAGCCCTGAGGAGAAAGCGCAAGGCCCTG
XM_005249574.1      CAGAAACTCCTGCGGCATCTGGTGCCCGCGGCAGCCCTGAGGAGAAAGCGCAAGGCCCTG
XM_005249572.1      CAGAAACTCCTGCGGCATCTGGTGCCCGCGGCAGCCCTGAGGAGAAAGCGCAAGGCCCTG
NM_006092.2         CAGAAACTCCTGCGGCATCTGGTGCCCGCGGCAGCCCTGAGGAGAAAGCGCAAGGCCCTG
XM_005249573.1      CAGAAACTCCTGCGGCATCTGGTGCCCGCGGCAGCCCTGAGGAGAAAGCGCAAGGCCCTG
XM_005249568.1      CAGAAACTCCTGCGGCATCTGGTGCCCGCGGCAGCCCTGAGGAGAAAGCGCAAGGCCCTG
                    ************************************************************

HsCD00434337        TGGGCACACCTGTTTTCCAGCCTGCGGGGCTACCTGAAGAGCCTGCCCCGCGTTCAGGTC
XM_005249574.1      TGGGCACACCTGTTTTCCAGCCTGCGGGGCTACCTGAAGAGCCTGCCCCGCGTTCAGGTC
XM_005249572.1      TGGGCACACCTGTTTTCCAGCCTGCGGGGCTACCTGAAGAGCCTGCCCCGCGTTCAGGTC
NM_006092.2         TGGGCACACCTGTTTTCCAGCCTGCGGGGCTACCTGAAGAGCCTGCCCCGCGTTCAGGTC
XM_005249573.1      TGGGCACACCTGTTTTCCAGCCTGCGGGGCTACCTGAAGAGCCTGCCCCGCGTTCAGGTC
XM_005249568.1      TGGGCACACCTGTTTTCCAGCCTGCGGGGCTACCTGAAGAGCCTGCCCCGCGTTCAGGTC
                    ************************************************************

HsCD00434337        GAAAGCTTCAACCAGGTGCAGGCCATGCCCACGTTCATCTGGATGCTGCGCTGCATCTAC
XM_005249574.1      GAAAGCTTCAACCAGGTGCAGGCCATGCCCACGTTCATCTGGATGCTGCGCTGCATCTAC
XM_005249572.1      GAAAGCTTCAACCAGGTGCAGGCCATGCCCACGTTCATCTGGATGCTGCGCTGCATCTAC
NM_006092.2         GAAAGCTTCAACCAGGTGCAGGCCATGCCCACGTTCATCTGGATGCTGCGCTGCATCTAC
XM_005249573.1      GAAAGCTTCAACCAGGTGCAGGCCATGCCCACGTTCATCTGGATGCTGCGCTGCATCTAC
XM_005249568.1      GAAAGCTTCAACCAGGTGCAGGCCATGCCCACGTTCATCTGGATGCTGCGCTGCATCTAC
                    ************************************************************

HsCD00434337        GAGACACAGAGCCAGAAGGTGGGGCAGCTGGCGGCCAGGGGCATCTGCGCCAACTACCTC
XM_005249574.1      GAGACACAGAGCCAGAAGGTGGGGCAGCTGGCGGCCAGGGGCATCTGCGCCAACTACCTC
XM_005249572.1      GAGACACAGAGCCAGAAGGTGGGGCAGCTGGCGGCCAGGGGCATCTGCGCCAACTACCTC
NM_006092.2         GAGACACAGAGCCAGAAGGTGGGGCAGCTGGCGGCCAGGGGCATCTGCGCCAACTACCTC
XM_005249573.1      GAGACACAGAGCCAGAAGGTGGGGCAGCTGGCGGCCAGGGGCATCTGCGCCAACTACCTC
XM_005249568.1      GAGACACAGAGCCAGAAGGTGGGGCAGCTGGCGGCCAGGGGCATCTGCGCCAACTACCTC
                    ************************************************************

HsCD00434337        AAGCTGACCTACTGCAACGCCTGCTCGGCCGACTGCAGCGCCCTCTCCTTCGTCCTGCAT
XM_005249574.1      AAGCTGACCTACTGCAACGCCTGCTCGGCCGACTGCAGCGCCCTCTCCTTCGTCCTGCAT
XM_005249572.1      AAGCTGACCTACTGCAACGCCTGCTCGGCCGACTGCAGCGCCCTCTCCTTCGTCCTGCAT
NM_006092.2         AAGCTGACCTACTGCAACGCCTGCTCGGCCGACTGCAGCGCCCTCTCCTTCGTCCTGCAT
XM_005249573.1      AAGCTGACCTACTGCAACGCCTGCTCGGCCGACTGCAGCGCCCTCTCCTTCGTCCTGCAT
XM_005249568.1      AAGCTGACCTACTGCAACGCCTGCTCGGCCGACTGCAGCGCCCTCTCCTTCGTCCTGCAT
                    ************************************************************

HsCD00434337        CACTTCCCCAAGCGGCTGGCCCTAGACCTAGACAACAACAATCTCAACGACTACGGCGTG
XM_005249574.1      CACTTCCCCAAGCGGCTGGCCCTAGACCTAGACAACAACAATCTCAACGACTACGGCGTG
XM_005249572.1      CACTTCCCCAAGCGGCTGGCCCTAGACCTAGACAACAACAATCTCAACGACTACGGCGTG
NM_006092.2         CACTTCCCCAAGCGGCTGGCCCTAGACCTAGACAACAACAATCTCAACGACTACGGCGTG
XM_005249573.1      CACTTCCCCAAGCGGCTGGCCCTAGACCTAGACAACAACAATCTCAACGACTACGGCGTG
XM_005249568.1      CACTTCCCCAAGCGGCTGGCCCTAGACCTAGACAACAACAATCTCAACGACTACGGCGTG
                    ************************************************************

HsCD00434337        CGGGAGCTGCAGCCCTGCTTCAGCCGCCTCACTGTTCTCAGACTCAGCGTAAACCAGATC
XM_005249574.1      CGGGAGCTGCAGCCCTGCTTCAGCCGCCTCACTGTTCTCAGACTCAGCGTAAACCAGATC
XM_005249572.1      CGGGAGCTGCAGCCCTGCTTCAGCCGCCTCACTGTTCTCAGACTCAGCGTAAACCAGATC
NM_006092.2         CGGGAGCTGCAGCCCTGCTTCAGCCGCCTCACTGTTCTCAGACTCAGCGTAAACCAGATC
XM_005249573.1      CGGGAGCTGCAGCCCTGCTTCAGCCGCCTCACTGTTCTCAGACTCAGCGTAAACCAGATC
XM_005249568.1      CGGGAGCTGCAGCCCTGCTTCAGCCGCCTCACTGTTCTCAGACTCAGCGTAAACCAGATC
                    ************************************************************

HsCD00434337        ACTGACGGTGGGGTAAAGGTGCTAAGCGAAGAGCTGACCAAATACAAAATTGTGACCTAT
XM_005249574.1      ACTGACGGTGGGGTAAAGGTGCTAAGCGAAGAGCTGACCAAATACAAAATTGTGACCTAT
XM_005249572.1      ACTGACGGTGGGGTAAAGGTGCTAAGCGAAGAGCTGACCAAATACAAAATTGTGACCTAT
NM_006092.2         ACTGACGGTGGGGTAAAGGTGCTAAGCGAAGAGCTGACCAAATACAAAATTGTGACCTAT
XM_005249573.1      ACTGACGGTGGGGTAAAGGTGCTAAGCGAAGAGCTGACCAAATACAAAATTGTGACCTAT
XM_005249568.1      ACTGACGGTGGGGTAAAGGTGCTAAGCGAAGAGCTGACCAAATACAAAATTGTGACCTAT
                    ************************************************************

HsCD00434337        TTGGGTTTATACAACAACCAGATCACCGATGTCGGAGCCAGGTACGTCACCAAAATCCTG
XM_005249574.1      TTGGGTTTATACAACAACCAGATCACCGATGTCGGAGCCAGGTACGTCACCAAAATCCTG
XM_005249572.1      TTGGGTTTATACAACAACCAGATCACCGATGTCGGAGCCAGGTACGTCACCAAAATCCTG
NM_006092.2         TTGGGTTTATACAACAACCAGATCACCGATGTCGGAGCCAGGTACGTCACCAAAATCCTG
XM_005249573.1      TTGGGTTTATACAACAACCAGATCACCGATGTCGGAGCCAGGTACGTCACCAAAATCCTG
XM_005249568.1      TTGGGTTTATACAACAACCAGATCACCGATGTCGGAGCCAGGTACGTCACCAAAATCCTG
                    ************************************************************

HsCD00434337        GATGAATGCAAAGGCCTCACGCATCTTAAACTGGGAAAAAACAAAATAACAAGTGAAGGA
XM_005249574.1      GATGAATGCAAAGGCCTCACGCATCTTAAACTGGGAAAAAACAAAATAACAAGTGAAGGA
XM_005249572.1      GATGAATGCAAAGGCCTCACGCATCTTAAACTGGGAAAAAACAAAATAACAAGTGAAGGA
NM_006092.2         GATGAATGCAAAGGCCTCACGCATCTTAAACTGGGAAAAAACAAAATAACAAGTGAAGGA
XM_005249573.1      GATGAATGCAAAGGCCTCACGCATCTTAAACTGGGAAAAAACAAAATAACAAGTGAAGGA
XM_005249568.1      GATGAATGCAAAGGCCTCACGCATCTTAAACTGGGAAAAAACAAAATAACAAGTGAAGGA
                    ************************************************************

HsCD00434337        GGGAAGTATCTCGCCCTGGCTGTGAAGAACAGCAAATCAATCTCTGAGGTTGGGATGTGG
XM_005249574.1      GGGAAGTATCTCGCCCTGGCTGTGAAGAACAGCAAATCAATCTCTGAGGTTG--------
XM_005249572.1      GGGAAGTATCTCGCCCTGGCTGTGAAGAACAGCAAATCAATCTCTGAGGTTGGGATGTGG
NM_006092.2         GGGAAGTATCTCGCCCTGGCTGTGAAGAACAGCAAATCAATCTCTGAGGTTGGGATGTGG
XM_005249573.1      GGGAAGTATCTCGCCCTGGCTGTGAAGAACAGCAAATCAATCTCTGAGGTTGG-------
XM_005249568.1      GGGAAGTATCTCGCCCTGGCTGTGAAGAACAGCAAATCAATCTCTGAGGTTGGGATGTGG
                    ****************************************************        

HsCD00434337        GGCAATCAAGTTGGGGATGAAGGAGCAAAAGCCTTCGCAGAGGCTCTGCGGAACCACCCC
XM_005249574.1      ------------------------------------------------------------
XM_005249572.1      GGCAATCAAGTTGGGGATGAAGGAGCAAAAGCCTTCGCAGAGGCTCTGCGGAACCACCCC
NM_006092.2         GGCAATCAAGTTGGGGATGAAGGAGCAAAAGCCTTCGCAGAGGCTCTGCGGAACCACCCC
XM_005249573.1      ------------------------------------------------------------
XM_005249568.1      GGCAATCAAGTTGGGGATGAAGGAGCAAAAGCCTTCGCAGAGGCTCTGCGGAACCACCCC
                                                                                

HsCD00434337        AGCTTGACCACCCTGAGTCTTGCGTCCAACGGCATCTCCACAGAAGGAGGAAAGAGCCTT
XM_005249574.1      ------------------------------------------------------------
XM_005249572.1      AGCTTGACCACCCTGAGTCTTGCGTCCAACGGCATCTCCACAGAAGGAGGAAAGAGCCTT
NM_006092.2         AGCTTGACCACCCTGAGTCTTGCGTCCAACGGCATCTCCACAGAAGGAGGAAAGAGCCTT
XM_005249573.1      -----------------TCTTGCGTCCAACGGCATCTCCACAGAAGGAGGAAAGAGCCTT
XM_005249568.1      AGCTTGACCACCCTGAGTCTTGCGTCCAACGGCATCTCCACAGAAGGAGGAAAGAGCCTT
                                                                                

HsCD00434337        GCGAGGGCCCTGCAGCAGAACACGTCTCTAGAAATACTGTGGCTGACCCAAAATGAACTC
XM_005249574.1      ------------------------------------------------------------
XM_005249572.1      GCGAGGGCCCTGCAGCAGAACACGTCTCTAGAAATACTGTGGCTGACCCAAAATGAACTC
NM_006092.2         GCGAGGGCCCTGCAGCAGAACACGTCTCTAGAAATACTGTGGCTGACCCAAAATGAACTC
XM_005249573.1      GCGAGGGCCCTGCAGCAGAACACGTCTCTAGAAATACTGTGGCTGACCCAAAATGAACTC
XM_005249568.1      GCGAGGGCCCTGCAGCAGAACACGTCTCTAGAAATACTGTGGCTGACCCAAAATGAACTC
                                                                                

HsCD00434337        AACGATGAAGTGGCAGAGAGTTTGGCAGAAATGTTGAAAGTCAACCAGACGTTAAAGCAT
XM_005249574.1      ------------------------------------------------------------
XM_005249572.1      AACGATGAAGTGGCAGAGAGTTTGGCAGAAATGTTGAAAGTCAACCAGACGTTAAAGCAT
NM_006092.2         AACGATGAAGTGGCAGAGAGTTTGGCAGAAATGTTGAAAGTCAACCAGACGTTAAAGCAT
XM_005249573.1      AACGATGAAGTGGCAGAGAGTTTGGCAGAAATGTTGAAAGTCAACCAGACGTTAAAGCAT
XM_005249568.1      AACGATGAAGTGGCAGAGAGTTTGGCAGAAATGTTGAAAGTCAACCAGACGTTAAAGCAT
                                                                                

HsCD00434337        TTATGGCTTATCCAGAATCAGATCACAGCTAAGGGGACTGCCCAGCTGGCAGATGCGTTA
XM_005249574.1      ----GGCTTATCCAGAATCAGATCACAGCTAAGGGGACTGCCCAGCTGGCAGATGCGTTA
XM_005249572.1      TTATGGCTTATCCAGAATCAGATCACAGCTAAGGGGACTGCCCAGCTGGCAGATGCGTTA
NM_006092.2         TTATGGCTTATCCAGAATCAGATCACAGCTAAGGGGACTGCCCAGCTGGCAGATGCGTTA
XM_005249573.1      TTATGGCTTATCCAGAATCAGATCACAGCTAAGGGGACTGCCCAGCTGGCAGATGCGTTA
XM_005249568.1      TTATGGCTTATCCAGAATCAGATCACAGCTAAGGGGACTGCCCAGCTGGCAGATGCGTTA
                        ********************************************************

HsCD00434337        CAGAGCAACACTGGCATAACAGAGATTTGCCTAAATGGAAACCTGATAAAACCAGAGGAG
XM_005249574.1      CAGAGCAACACTGGCATAACAGAGATTTGCCTAAATGGAAACCTGATAAAACCAGAGGAG
XM_005249572.1      CAGAGCAACACTGGCATAACAGAGATTTGCCTAAATGGAAACCTGATAAAACCAGAGGAG
NM_006092.2         CAGAGCAACACTGGCATAACAGAGATTTGCCTAAATGGAAACCTGATAAAACCAGAGGAG
XM_005249573.1      CAGAGCAACACTGGCATAACAGAGATTTGCCTAAATGGAAACCTGATAAAACCAGAGGAG
XM_005249568.1      CAGAGCAACACTGGCATAACAGAGATTTGCCTAAATGGAAACCTGATAAAACCAGAGGAG
                    ************************************************************

HsCD00434337        GCCAAAGTCTATGAAGATGAGAAGCGGATTATCTGTTTC---
XM_005249574.1      GCCAAAGTCTATGAAGATGAGAAGCGGATTATCTGTTTCTGA
XM_005249572.1      GCCAAAGTCTATGAAGATGAGAAGCGGATTATCTGTTTCTGA
NM_006092.2         GCCAAAGTCTATGAAGATGAGAAGCGGATTATCTGTTTCTGA
XM_005249573.1      GCCAAAGTCTATGAAGATGAGAAGCGGATTATCTGTTTCTGA
XM_005249568.1      GCCAAAGTCTATGAAGATGAGAAGCGGATTATCTGTTTCTGA
                    ***************************************   

Pathways

Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signaling by Interleukins
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : NOD pathway

Clone

Original Clone ID : N/A

Organism


TAX_ID : 9606
Species Specific ID: 10392

Genome

Chromosome : 7
Map Location : 7p15-p14
Ensembl : ENSG00000106100

Reagents

Labome : NOD1-antibody