DNASU Plasmid Repository • 480.965.5697 | Email

C1QB (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  C1QB
Gene Name:  complement component 1, q subcomponent, B chain
Sequence             
Original Clone ID: ccsbBroad304_00181
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00434854

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 760nts         Open reading frame : 1 to 760
Reference Sequence Alignment

ATGATGATGAAGATCCCATGGGGCAGCATCCCAGTACTGATGTTGCTCCTGCTCCTGGGC
CTAATCGATATCTCCCAGGCCCAGCTCAGCTGCACCGGGCCCCCAGCCATCCCTGGCATC
CCGGGTATCCCTGGGACACCTGGCCCCGATGGCCAACCTGGGACCCCAGGGATAAAAGGA
GAGAAAGGGCTTCCAGGGCTGGCTGGAGACCATGGTGAGTTCGGAGAGAAGGGAGACCCA
GGGATTCCTGGGAATCCAGGAAAAGTCGGCCCCAAGGGCCCCATGGGCCCTAAAGGTGGC
CCAGGGGCCCCTGGAGCCCCAGGCCCCAAAGGTGAATCGGGAGACTACAAGGCCACCCAG
AAAATCGCCTTCTCTGCCACAAGAACCATCAACGTCCCCCTGCGCCGGGACCAGACCATC
CGCTTCGACCACGTGATCACCAACATGAACAACAATTATGAGCCCCGCAGTGGCAAGTTC
ACCTGCAAGGTGCCCGGTCTCTACTACTTCACCTACCACGCCAGCTCTCGAGGGAACCTG
TGCGTGAACCTCATGCGTGGCCGGGAGCGTGCACAGAAGGTGGTCACCTTCTGTGACTAT
GCCTACAACACCTTCCAGGTCACCACCGGTGGCATGGTCCTCAAGCTGGAGCAGGGGGAG
AACGTCTTCCTGCAGGCCACCGACAAGAACTCACTACTGGGCATGGAGGGTGCCAACAGC
ATCTTTTCCGGGTTCCTGCTCTTTCCAGATATGGAGGCC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : C1QB
Symbol Nomenclature : C1QB
Designation : complement C1q subcomponent subunit B|complement component 1, q subcomponent, beta polypeptide|complement component C1q, B chain|complement subcomponent C1q chain B
Full Nomenclature : complement component 1, q subcomponent, B chain
GENEID : 713
Locus Tag : RP4-815O16.3
GenBank Accession : DQ894720
HGNC : 1242
MIM : 120570
Vega : OTTHUMG00000002896
Target GenBank: DQ894720

 

Reference Sequence Alignment

  

HsCD00434854        ATGATGATGAAGATCCCATGGGGCAGCATCCCAGTACTGATGTTGCTCCTGCTCCTGGGC
XM_005245982.1      ATGATGATGAAGATCCCATGGGGCAGCATCCCAGTACTGATGTTGCTCCTGCTCCTGGGC
NM_000491.3         ATGATGATGAAGATCCCATGGGGCAGCATCCCAGTACTGATGTTGCTCCTGCTCCTGGGC
                    ************************************************************

HsCD00434854        CTAATCGATATCTCCCAGGCCCAGCTCAGCTGCACCGGGCCCCCAGCCATCCCTGGCATC
XM_005245982.1      CTAATCGATATCTCCCAGGCCCAGCTCAGCTGCACCGGGCCCCCAGCCATCCCTGGCATC
NM_000491.3         CTAATCGATATCTCCCAGGCCCAGCTCAGCTGCACCGGGCCCCCAGCCATCCCTGGCATC
                    ************************************************************

HsCD00434854        CCGGGTATCCCTGGGACACCTGGCCCCGATGGCCAACCTGGGACCCCAGGGATAAAAGGA
XM_005245982.1      CCGGGTATCCCTGGGACACCTGGCCCCGATGGCCAACCTGGGACCCCAGGGATAAAAGGA
NM_000491.3         CCGGGTATCCCTGGGACACCTGGCCCCGATGGCCAACCTGGGACCCCAGGGATAAAAGGA
                    ************************************************************

HsCD00434854        GAGAAAGGGCTTCCAGGGCTGGCTGGAGACCATGGTGAGTTCGGAGAGAAGGGAGACCCA
XM_005245982.1      GAGAAAGGGCTTCCAGGGCTGGCTGGAGACCATGGTGAGTTCGGAGAGAAGGGAGACCCA
NM_000491.3         GAGAAAGGGCTTCCAGGGCTGGCTGGAGACCATGGTGAGTTCGGAGAGAAGGGAGACCCA
                    ************************************************************

HsCD00434854        GGGATTCCTGGGAATCCAGGAAAAGTCGGCCCCAAGGGCCCCATGGGCCCTAAAGGTGGC
XM_005245982.1      GGGATTCCTGGGAATCCAGGAAAAGTCGGCCCCAAGGGCCCCATGGGCCCTAAAGGTGGC
NM_000491.3         GGGATTCCTGGGAATCCAGGAAAAGTCGGCCCCAAGGGCCCCATGGGCCCTAAAGGTGGC
                    ************************************************************

HsCD00434854        CCAGGGGCCCCTGGAGCCCCAGGCCCCAAAGGTGAATCGGGAGACTACAAGGCCACCCAG
XM_005245982.1      CCAGGGGCCCCTGGAGCCCCAGGCCCCAAAGGTGAATCGGGAGACTACAAGGCCACCCAG
NM_000491.3         CCAGGGGCCCCTGGAGCCCCAGGCCCCAAAGGTGAATCGGGAGACTACAAGGCCACCCAG
                    ************************************************************

HsCD00434854        AAAATCGCCTTCTCTGCCACAAGAACCATCAACGTCCCCCTGCGCCGGGACCAGACCATC
XM_005245982.1      AAAATCGCCTTCTCTGCCACAAGAACCATCAACGTCCCCCTGCGCCGGGACCAGACCATC
NM_000491.3         AAAATCGCCTTCTCTGCCACAAGAACCATCAACGTCCCCCTGCGCCGGGACCAGACCATC
                    ************************************************************

HsCD00434854        CGCTTCGACCACGTGATCACCAACATGAACAACAATTATGAGCCCCGCAGTGGCAAGTTC
XM_005245982.1      CGCTTCGACCACGTGATCACCAACATGAACAACAATTATGAGCCCCGCAGTGGCAAGTTC
NM_000491.3         CGCTTCGACCACGTGATCACCAACATGAACAACAATTATGAGCCCCGCAGTGGCAAGTTC
                    ************************************************************

HsCD00434854        ACCTGCAAGGTGCCCGGTCTCTACTACTTCACCTACCACGCCAGCTCTCGAGGGAACCTG
XM_005245982.1      ACCTGCAAGGTGCCCGGTCTCTACTACTTCACCTACCACGCCAGCTCTCGAGGGAACCTG
NM_000491.3         ACCTGCAAGGTGCCCGGTCTCTACTACTTCACCTACCACGCCAGCTCTCGAGGGAACCTG
                    ************************************************************

HsCD00434854        TGCGTGAACCTCATGCGTGGCCGGGAGCGTGCACAGAAGGTGGTCACCTTCTGTGACTAT
XM_005245982.1      TGCGTGAACCTCATGCGTGGCCGGGAGCGTGCACAGAAGGTGGTCACCTTCTGTGACTAT
NM_000491.3         TGCGTGAACCTCATGCGTGGCCGGGAGCGTGCACAGAAGGTGGTCACCTTCTGTGACTAT
                    ************************************************************

HsCD00434854        GCCTACAACACCTTCCAGGTCACCACCGGTGGCATGGTCCTCAAGCTGGAGCAGGGGGAG
XM_005245982.1      GCCTACAACACCTTCCAGGTCACCACCGGTGGCATGGTCCTCAAGCTGGAGCAGGGGGAG
NM_000491.3         GCCTACAACACCTTCCAGGTCACCACCGGTGGCATGGTCCTCAAGCTGGAGCAGGGGGAG
                    ************************************************************

HsCD00434854        AACGTCTTCCTGCAGGCCACCGACAAGAACTCACTACTGGGCATGGAGGGTGCCAACAGC
XM_005245982.1      AACGTCTTCCTGCAGGCCACCGACAAGAACTCACTACTGGGCATGGAGGGTGCCAACAGC
NM_000491.3         AACGTCTTCCTGCAGGCCACCGACAAGAACTCACTACTGGGCATGGAGGGTGCCAACAGC
                    ************************************************************

HsCD00434854        ATCTTTTCCGGGTTCCTGCTCTTTCCAGATATGGAGGCC---
XM_005245982.1      ATCTTTTCCGGGTTCCTGCTCTTTCCAGATATGGAGGCCTGA
NM_000491.3         ATCTTTTCCGGGTTCCTGCTCTTTCCAGATATGGAGGCCTGA
                    ***************************************   

Pathways

Reactome : Classical antibody-mediated complement activation
Reactome : Complement cascade
Reactome : Creation of C4 and C2 activators
Reactome : Immune System
Reactome : Initial triggering of complement
Reactome : Innate Immune System
WikiPathway : Complement Activation, Classical Pathway
WikiPathway : Complement and Coagulation Cascades

Protein

SMART domain : C1Q : Complement component C1q domain.
HPRD : 00394

Clone

Original Clone ID : ccsbBroad304_00181

Organism


TAX_ID : 9606
Species Specific ID: 713

Genome

Chromosome : 1
Map Location : 1p36.12
Ensembl : ENSG00000173369

Reagents

Labome : C1QB-antibody