DNASU Plasmid Repository • 480.965.5697 | Email

FOS (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FOS
Gene Name:  FBJ murine osteosarcoma viral oncogene homolog
Sequence             
Original Clone ID: ccsbBroad304_06220
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 24379408
Title: The FOS Transcription Factor Family Differentially Controls Trophoblast Migration and Invasion.
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00434995

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1141nts         Open reading frame : 1 to 1141
Reference Sequence Alignment

ATGATGTTCTCGGGCTTCAACGCAGACTACGAGGCGTCATCCTCCCGCTGCAGCAGCGCG
TCCCCGGCCGGGGATAGCCTCTCTTACTACCACTCACCCGCAGACTCCTTCTCCAGCATG
GGCTCGCCTGTCAACGCGCAGGACTTCTGCACGGACCTGGCCGTCTCCAGTGCCAACTTC
ATTCCCACGGTCACTGCCATCTCGACCAGTCCGGACCTGCAGTGGCTGGTGCAGCCCGCC
CTCGTCTCCTCTGTGGCCCCATCGCAGACCAGAGCCCCTCACCCTTTCGGAGTCCCCGCC
CCCTCCGCTGGGGCTTACTCCAGGGCTGGCGTTGTGAAGACCATGACAGGAGGCCGAGCG
CAGAGCATTGGCAGGAGGGGCAAGGTGGAACAGTTATCTCCAGAAGAAGAAGAGAAAAGG
AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAG
CTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAG
ACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCAC
CGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCC
CTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACC
CTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGC
AGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCATCCAGGCCC
AGTGGCTCTGAGACAGCCCGCTCCGTGCCAGACATGGACCTATCTGGGTCCTTCTATGCA
GCAGACTGGGAGCCTCTGCACAGTGGCTCCCTGGGGATGGGGCCCATGGCCACAGAGCTG
GAGCCCCTGTGCACTCCGGTGGTCACCTGTACTCCCAGCTGCACTGCTTACACGTCTTCC
TTCGTCTTCACCTACCCCGAGGCTGACTCCTTCCCCAGCTGTGCAGCTGCCCACCGCAAG
GGCAGCAGCAGCAATGAGCCTTCCTCTGACTCGCTCAGCTCACCCACGCTGCTGGCCCTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FOS
Symbol Nomenclature : FOS
SYNONYM : AP-1; C-FOS; p55
Designation : FBJ murine osteosarcoma viral (v-fos) oncogene homolog (oncogene FOS)|G0/G1 switch regulatory protein 7|activator protein 1|cellular oncogene c-fos|proto-oncogene c-Fos
Full Nomenclature : FBJ murine osteosarcoma viral oncogene homolog
GENEID : 2353
GenBank Accession : DQ896750
HGNC : 3796
MIM : 164810
Vega : OTTHUMG00000171774
Target GenBank: DQ896750

 

Reference Sequence Alignment

  

HsCD00434995      ATGATGTTCTCGGGCTTCAACGCAGACTACGAGGCGTCATCCTCCCGCTGCAGCAGCGCG
NM_005252.3       ATGATGTTCTCGGGCTTCAACGCAGACTACGAGGCGTCATCCTCCCGCTGCAGCAGCGCG
                  ************************************************************

HsCD00434995      TCCCCGGCCGGGGATAGCCTCTCTTACTACCACTCACCCGCAGACTCCTTCTCCAGCATG
NM_005252.3       TCCCCGGCCGGGGATAGCCTCTCTTACTACCACTCACCCGCAGACTCCTTCTCCAGCATG
                  ************************************************************

HsCD00434995      GGCTCGCCTGTCAACGCGCAGGACTTCTGCACGGACCTGGCCGTCTCCAGTGCCAACTTC
NM_005252.3       GGCTCGCCTGTCAACGCGCAGGACTTCTGCACGGACCTGGCCGTCTCCAGTGCCAACTTC
                  ************************************************************

HsCD00434995      ATTCCCACGGTCACTGCCATCTCGACCAGTCCGGACCTGCAGTGGCTGGTGCAGCCCGCC
NM_005252.3       ATTCCCACGGTCACTGCCATCTCGACCAGTCCGGACCTGCAGTGGCTGGTGCAGCCCGCC
                  ************************************************************

HsCD00434995      CTCGTCTCCTCTGTGGCCCCATCGCAGACCAGAGCCCCTCACCCTTTCGGAGTCCCCGCC
NM_005252.3       CTCGTCTCCTCCGTGGCCCCATCGCAGACCAGAGCCCCTCACCCTTTCGGAGTCCCCGCC
                  *********** ************************************************

HsCD00434995      CCCTCCGCTGGGGCTTACTCCAGGGCTGGCGTTGTGAAGACCATGACAGGAGGCCGAGCG
NM_005252.3       CCCTCCGCTGGGGCTTACTCCAGGGCTGGCGTTGTGAAGACCATGACAGGAGGCCGAGCG
                  ************************************************************

HsCD00434995      CAGAGCATTGGCAGGAGGGGCAAGGTGGAACAGTTATCTCCAGAAGAAGAAGAGAAAAGG
NM_005252.3       CAGAGCATTGGCAGGAGGGGCAAGGTGGAACAGTTATCTCCAGAAGAAGAAGAGAAAAGG
                  ************************************************************

HsCD00434995      AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAG
NM_005252.3       AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAG
                  ************************************************************

HsCD00434995      CTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAG
NM_005252.3       CTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAG
                  ************************************************************

HsCD00434995      ACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCAC
NM_005252.3       ACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCAC
                  ************************************************************

HsCD00434995      CGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCC
NM_005252.3       CGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCC
                  ************************************************************

HsCD00434995      CTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACC
NM_005252.3       CTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACC
                  ************************************************************

HsCD00434995      CTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGC
NM_005252.3       CTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGC
                  ************************************************************

HsCD00434995      AGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCATCCAGGCCC
NM_005252.3       AGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCATCCAGGCCC
                  ************************************************************

HsCD00434995      AGTGGCTCTGAGACAGCCCGCTCCGTGCCAGACATGGACCTATCTGGGTCCTTCTATGCA
NM_005252.3       AGTGGCTCTGAGACAGCCCGCTCCGTGCCAGACATGGACCTATCTGGGTCCTTCTATGCA
                  ************************************************************

HsCD00434995      GCAGACTGGGAGCCTCTGCACAGTGGCTCCCTGGGGATGGGGCCCATGGCCACAGAGCTG
NM_005252.3       GCAGACTGGGAGCCTCTGCACAGTGGCTCCCTGGGGATGGGGCCCATGGCCACAGAGCTG
                  ************************************************************

HsCD00434995      GAGCCCCTGTGCACTCCGGTGGTCACCTGTACTCCCAGCTGCACTGCTTACACGTCTTCC
NM_005252.3       GAGCCCCTGTGCACTCCGGTGGTCACCTGTACTCCCAGCTGCACTGCTTACACGTCTTCC
                  ************************************************************

HsCD00434995      TTCGTCTTCACCTACCCCGAGGCTGACTCCTTCCCCAGCTGTGCAGCTGCCCACCGCAAG
NM_005252.3       TTCGTCTTCACCTACCCCGAGGCTGACTCCTTCCCCAGCTGTGCAGCTGCCCACCGCAAG
                  ************************************************************

HsCD00434995      GGCAGCAGCAGCAATGAGCCTTCCTCTGACTCGCTCAGCTCACCCACGCTGCTGGCCCTG
NM_005252.3       GGCAGCAGCAGCAATGAGCCTTCCTCTGACTCGCTCAGCTCACCCACGCTGCTGGCCCTG
                  ************************************************************

HsCD00434995      ---
NM_005252.3       TGA
                     

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : BCR signaling pathway
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Calcium signaling in the CD4+ TCR pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FGF signaling pathway
NCI : FOXA1 transcription factor network
NCI : FOXM1 transcription factor network
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : Glucocorticoid receptor regulatory network
NCI : HIF-1-alpha transcription factor network
NCI : IL12 signaling mediated by STAT4
NCI : IL12-mediated signaling events
NCI : IL2-mediated signaling events
NCI : IL6-mediated signaling events
NCI : LPA receptor mediated events
NCI : Nongenotropic Androgen signaling
NCI : Osteopontin-mediated events
NCI : PDGFR-alpha signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Telomerase
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : RhoA signaling pathway
NCI : S1P2 pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : Huntington disease
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : T cell activation
Reactome : Activated TLR4 signalling
Reactome : Activation of the AP-1 family of transcription factors
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : FCERI mediated MAPK activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Oxidative Stress Induced Senescence
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Estrogen signaling pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Oxidative Stress
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Selenium Metabolism and Selenoproteins
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : BRLZ : basic region leucin zipper
HPRD : 01275

Clone

Original Clone ID : ccsbBroad304_06220

Organism


TAX_ID : 9606
Species Specific ID: 2353

Genome

Chromosome : 14
Map Location : 14q24.3
Ensembl : ENSG00000170345

Reagents

Labome : c-Fos-antibody