DNASU Plasmid Repository • 480.965.5697 | Email

CYC1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CYC1
Gene Name:  cytochrome c-1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH177384.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00043503

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 978nts         Open reading frame : 1 to 978
Reference Sequence Alignment

ATGGCGGCAGCTGCGGCTTCGCTTCGCGGGGTAGTGTTGGGCCCGCGGGGCGCGGGGCTC
CCGGGCGCGCGTGCCCGGGGTCTGCTGTGCAGCGCGCGGCCCGGGCAGCTCCCGCTACGG
ACACCTCAGGCAGTGGCCTTGTCGTCGAAGTCTGGCCTTTCCCGAGGCCGGAAAGTGATG
CTGTCAGCGCTGGGCATGCTGGCGGCAGGGGGTGCGGGGCTGGCCGTGGCTCTGCATTCG
GCTGTGAGTGCCAGTGACCTGGAGCTGCACCCCCCCAGCTATCCGTGGTCTCACCGTGGC
CTCCTCTCTTCCTTGGACCACACCAGCATCCGGAGGGGTTTCCAGGTATATAAGCAGGTG
TGCGCCTCCTGCCACAGCATGGACTTCGTGGCCTACCGCCACCTGGTGGGCGTGTGCTAC
ACGGAGGATGAAGCTAAGGAGCTGGCTGCGGAGGTGGAGGTTCAAGACGGCCCCAATGAA
GATGGGGAGATGTTCATGCGGCCAGGGAAGCTGTTCGACTATTTCCCAAAACCATACCCC
AACAGTGAGGCTGCTCGAGCTGCCAACAACGGAGCATTGCCCCCTGACCTCAGCTACATC
GTGCGAGCTAGGCATGGTGGTGAGGACTACGTCTTCTCCCTGCTCACGGGCTACTGCGAG
CCACCCACCGGGGTGTCACTGCGGGAAGGTCTCTACTTCAACCCCTACTTTCCTGGCCAG
GCCATTGCCATGGCCCCTCCCATCTACACAGATGTCTTAGAGTTTGACGATGGCACCCCA
GCTACCATGTCCCAGATAGCCAAGGATGTGTGCACCTTCCTGCGCTGGGCATCTGAGCCA
GAGCACGACCATCGAAAACGCATGGGGCTCAAGATGTTGATGATGATGGCTCTGCTGGTG
CCCCTGGTCTACACCATAAAGCGGCACAAGTGGTCAGTCCTGAAGAGTCGGAAGCTGGCA
TATCGGCCGCCCAAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 982
Start on reference sequence 5
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CYC1
Symbol Nomenclature : CYC1
SYNONYM : MC3DN6; UQCR4
Designation : complex III subunit 4|complex III subunit IV|cytochrome b-c1 complex subunit 4|cytochrome c1, heme protein, mitochondrial|ubiquinol-cytochrome-c reductase complex cytochrome c1 subunit
Full Nomenclature : cytochrome c-1
GENEID : 1537
HGNC : 2579
MIM : 123980
Vega : OTTHUMG00000165242
Target GenBank: BC020566

 

Reference Sequence Alignment

  

HsCD00043503      ATGGCGGCAGCTGCGGCTTCGCTTCGCGGGGTAGTGTTGGGCCCGCGGGGCGCGGGGCTC
NM_001916.4       ATGGCGGCAGCTGCGGCTTCGCTTCGCGGGGTAGTGTTGGGCCCGCGGGGCGCGGGGCTC
                  ************************************************************

HsCD00043503      CCGGGCGCGCGTGCCCGGGGTCTGCTGTGCAGCGCGCGGCCCGGGCAGCTCCCGCTACGG
NM_001916.4       CCGGGCGCGCGTGCCCGGGGTCTGCTGTGCAGCGCGCGTCCCGGGCAGCTCCCGCTACGG
                  ************************************** *********************

HsCD00043503      ACACCTCAGGCAGTGGCCTTGTCGTCGAAGTCTGGCCTTTCCCGAGGCCGGAAAGTGATG
NM_001916.4       ACACCTCAGGCAGTGGCCTTGTCGTCGAAGTCTGGCCTTTCCCGAGGCCGGAAAGTGATG
                  ************************************************************

HsCD00043503      CTGTCAGCGCTGGGCATGCTGGCGGCAGGGGGTGCGGGGCTGGCCGTGGCTCTGCATTCG
NM_001916.4       CTGTCAGCGCTGGGCATGCTGGCGGCAGGGGGTGCGGGGCTGGCCGTGGCTCTGCATTCG
                  ************************************************************

HsCD00043503      GCTGTGAGTGCCAGTGACCTGGAGCTGCACCCCCCCAGCTATCCGTGGTCTCACCGTGGC
NM_001916.4       GCTGTGAGTGCCAGTGACCTGGAGCTGCACCCCCCCAGCTATCCGTGGTCTCACCGTGGC
                  ************************************************************

HsCD00043503      CTCCTCTCTTCCTTGGACCACACCAGCATCCGGAGGGGTTTCCAGGTATATAAGCAGGTG
NM_001916.4       CTCCTCTCTTCCTTGGACCACACCAGCATCCGGAGGGGTTTCCAGGTATATAAGCAGGTG
                  ************************************************************

HsCD00043503      TGCGCCTCCTGCCACAGCATGGACTTCGTGGCCTACCGCCACCTGGTGGGCGTGTGCTAC
NM_001916.4       TGCGCCTCCTGCCACAGCATGGACTTCGTGGCCTACCGCCACCTGGTGGGCGTGTGCTAC
                  ************************************************************

HsCD00043503      ACGGAGGATGAAGCTAAGGAGCTGGCTGCGGAGGTGGAGGTTCAAGACGGCCCCAATGAA
NM_001916.4       ACGGAGGATGAAGCTAAGGAGCTGGCTGCGGAGGTGGAGGTTCAAGACGGCCCCAATGAA
                  ************************************************************

HsCD00043503      GATGGGGAGATGTTCATGCGGCCAGGGAAGCTGTTCGACTATTTCCCAAAACCATACCCC
NM_001916.4       GATGGGGAGATGTTCATGCGGCCAGGGAAGCTGTTCGACTATTTCCCAAAACCATACCCC
                  ************************************************************

HsCD00043503      AACAGTGAGGCTGCTCGAGCTGCCAACAACGGAGCATTGCCCCCTGACCTCAGCTACATC
NM_001916.4       AACAGTGAGGCTGCTCGAGCTGCCAACAACGGAGCATTGCCCCCTGACCTCAGCTACATC
                  ************************************************************

HsCD00043503      GTGCGAGCTAGGCATGGTGGTGAGGACTACGTCTTCTCCCTGCTCACGGGCTACTGCGAG
NM_001916.4       GTGCGAGCTAGGCATGGTGGTGAGGACTACGTCTTCTCCCTGCTCACGGGCTACTGCGAG
                  ************************************************************

HsCD00043503      CCACCCACCGGGGTGTCACTGCGGGAAGGTCTCTACTTCAACCCCTACTTTCCTGGCCAG
NM_001916.4       CCACCCACCGGGGTGTCACTGCGGGAAGGTCTCTACTTCAACCCCTACTTTCCTGGCCAG
                  ************************************************************

HsCD00043503      GCCATTGCCATGGCCCCTCCCATCTACACAGATGTCTTAGAGTTTGACGATGGCACCCCA
NM_001916.4       GCCATTGCCATGGCCCCTCCCATCTACACAGATGTCTTAGAGTTTGACGATGGCACCCCA
                  ************************************************************

HsCD00043503      GCTACCATGTCCCAGATAGCCAAGGATGTGTGCACCTTCCTGCGCTGGGCATCTGAGCCA
NM_001916.4       GCTACCATGTCCCAGATAGCCAAGGATGTGTGCACCTTCCTGCGCTGGGCATCTGAGCCA
                  ************************************************************

HsCD00043503      GAGCACGACCATCGAAAACGCATGGGGCTCAAGATGTTGATGATGATGGCTCTGCTGGTG
NM_001916.4       GAGCACGACCATCGAAAACGCATGGGGCTCAAGATGTTGATGATGATGGCTCTGCTGGTG
                  ************************************************************

HsCD00043503      CCCCTGGTCTACACCATAAAGCGGCACAAGTGGTCAGTCCTGAAGAGTCGGAAGCTGGCA
NM_001916.4       CCCCTGGTCTACACCATAAAGCGGCACAAGTGGTCAGTCCTGAAGAGTCGGAAGCTGGCA
                  ************************************************************

HsCD00043503      TATCGGCCGCCCAAGTAG
NM_001916.4       TATCGGCCGCCCAAGTGA
                  ****************..

Pathways

Panther : FAS signaling pathway
Panther : Huntington disease
Reactome : Metabolism
Reactome : Metabolism of proteins
Reactome : Mitochondrial protein import
Reactome : Respiratory electron transport
Reactome : Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins.
Reactome : The citric acid (TCA) cycle and respiratory electron transport

Protein

UniProt : P08574
HPRD : 00480

Clone

Cloning Information : 177384
HIP Master Clone ID : 152529
Original Clone ID : FLH177384.01X

Organism


TAX_ID : 9606
Species Specific ID: 1537

Genome

Chromosome : 8
Map Location : 8q24.3
Ensembl : ENSG00000179091

Reagents

Labome : cytochrome-c-antibody