DNASU Plasmid Repository • 480.965.5697 | Email

IRF3 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IRF3
Gene Name:  interferon regulatory factor 3
Sequence             
Original Clone ID: ccsbBroad304_06458
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00435222

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1357nts         Open reading frame : 1 to 1357
Reference Sequence Alignment

ATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACCTGGGGCAA
CTGGAGGGCGTGGCCTGGGTGAACAAGAGCCGCACGCGCTTCCGCATCCCTTGGAAGCAC
GGCCTACGGCAGGATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCC
ACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTC
CGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCT
CACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCA
GACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTG
GATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTG
GCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACT
CCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAA
GAGTGGGAGTTCGAGGTGACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATC
TCCTGCCCGGAGGGCCTGCGGCTGGTGGGGTCCGAAGTGGGAGACAGGACGCTGCCTGGA
TGGCCAGTCACACTGCCAGACCCTGGCATGTCCCTGACAGACAGGGGAGTGATGAGCTAC
GTGAGGCATGTGCTGAGCTGCCTGGGTGGGGGACTGGCTCTCTGGCGGGCCGGGCAGTGG
CTCTGGGCCCAGCGGCTGGGGCACTGCCACACATACTGGGCAGTGAGCGAGGAGCTGCTC
CCCAACAGCGGGCATGGGCCTGATGGCGAGGTCCCCAAGGACAAGGAAGGAGGCGTGTTT
GACCTGGGGCCCTTCATTGTAGGCTCCTGGGCCCCCAGATCTGATTACCTTCACGGAAGG
AAGCGGACGCTCACCACGCTATGCCCTCTGGTTCTGTGTGGGGGAGTCATGGCCCCAGGA
CCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAGGTTGTGCCCACGTGCCTCAGGGCCTT
GGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCCCTGGAGAATACTGTGGACCTGCACAT
TTCCAACAGCCACCCACTCTCCCTCACCTCCGACCAGTACAAGGCCTACCTGCAGGACTT
GGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAGACCTGAGCCCTCGCTCCTCATGGTGT
GCCTCCAACCCCCCTGTTCCCCACCACCTCAACCAA


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IRF3
Symbol Nomenclature : IRF3
Full Nomenclature : interferon regulatory factor 3
GENEID : 3661
GenBank Accession : DQ896306
HGNC : 6118
MIM : 603734
Vega : OTTHUMG00000183287
Target GenBank: DQ896306

 

Reference Sequence Alignment

  

HsCD00435222        ATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACCTGGGGCAA
NM_001197122.1      ATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACCTGGGGCAA
                    ************************************************************

HsCD00435222        CTGGAGGGCGTGGCCTGGGTGAACAAGAGCCGCACGCGCTTCCGCATCCCTTGGAAGCAC
NM_001197122.1      CTGGAGGGCGTGGCCTGGGTGAACAAGAGCCGCACGCGCTTCCGCATCCCTTGGAAGCAC
                    ************************************************************

HsCD00435222        GGCCTACGGCAGGATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCC
NM_001197122.1      GGCCTACGGCAGGATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCC
                    ************************************************************

HsCD00435222        ACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTC
NM_001197122.1      ACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTC
                    ************************************************************

HsCD00435222        CGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCT
NM_001197122.1      CGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCT
                    ************************************************************

HsCD00435222        CACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCA
NM_001197122.1      CACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCA
                    ************************************************************

HsCD00435222        GACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTG
NM_001197122.1      GACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTG
                    ************************************************************

HsCD00435222        GATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTG
NM_001197122.1      GATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTG
                    ************************************************************

HsCD00435222        GCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACT
NM_001197122.1      GCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACT
                    ************************************************************

HsCD00435222        CCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAA
NM_001197122.1      CCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAA
                    ************************************************************

HsCD00435222        GAGTGGGAGTTCGAGGTGACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATC
NM_001197122.1      GAGTGGGAGTTCGAGGTGACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATC
                    ************************************************************

HsCD00435222        TCCTGCCCGGAGGGCCTGCGGCTGGTGGGGTCCGAAGTGGGAGACAGGACGCTGCCTGGA
NM_001197122.1      TCCTGCCCGGAGGGCCTGCGGCTGGTGGGGTCCGAAGTGGGAGACAGGACGCTGCCTGGA
                    ************************************************************

HsCD00435222        TGGCCAGTCACACTGCCAGACCCTGGCATGTCCCTGACAGACAGGGGAGTGATGAGCTAC
NM_001197122.1      TGGCCAGTCACACTGCCAGACCCTGGCATGTCCCTGACAGACAGGGGAGTGATGAGCTAC
                    ************************************************************

HsCD00435222        GTGAGGCATGTGCTGAGCTGCCTGGGTGGGGGACTGGCTCTCTGGCGGGCCGGGCAGTGG
NM_001197122.1      GTGAGGCATGTGCTGAGCTGCCTGGGTGGGGGACTGGCTCTCTGGCGGGCCGGGCAGTGG
                    ************************************************************

HsCD00435222        CTCTGGGCCCAGCGGCTGGGGCACTGCCACACATACTGGGCAGTGAGCGAGGAGCTGCTC
NM_001197122.1      CTCTGGGCCCAGCGGCTGGGGCACTGCCACACATACTGGGCAGTGAGCGAGGAGCTGCTC
                    ************************************************************

HsCD00435222        CCCAACAGCGGGCATGGGCCTGATGGCGAGGTCCCCAAGGACAAGGAAGGAGGCGTGTTT
NM_001197122.1      CCCAACAGCGGGCATGGGCCTGATGGCGAGGTCCCCAAGGACAAGGAAGGAGGCGTGTTT
                    ************************************************************

HsCD00435222        GACCTGGGGCCCTTCATTGTAGGCTCCTGGGCCCCCAGATCTGATTACCTTCACGGAAGG
NM_001197122.1      GACCTGGGGCCCTTCATTGTAGGCTCCTGGGCCCCCAGATCTGATTACCTTCACGGAAGG
                    ************************************************************

HsCD00435222        AAGCGGACGCTCACCACGCTATGCCCTCTGGTTCTGTGTGGGGGAGTCATGGCCCCAGGA
NM_001197122.1      AAGCGGACGCTCACCACGCTATGCCCTCTGGTTCTGTGTGGGGGAGTCATGGCCCCAGGA
                    ************************************************************

HsCD00435222        CCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAGGTTGTGCCCACGTGCCTCAGGGCCTT
NM_001197122.1      CCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAGGTTGTGCCCACGTGCCTCAGGGCCTT
                    ************************************************************

HsCD00435222        GGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCCCTGGAGAATACTGTGGACCTGCACAT
NM_001197122.1      GGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCCCTGGAGAATACTGTGGACCTGCACAT
                    ************************************************************

HsCD00435222        TTCCAACAGCCACCCACTCTCCCTCACCTCCGACCAGTACAAGGCCTACCTGCAGGACTT
NM_001197122.1      TTCCAACAGCCACCCACTCTCCCTCACCTCCGACCAGTACAAGGCCTACCTGCAGGACTT
                    ************************************************************

HsCD00435222        GGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAGACCTGAGCCCTCGCTCCTCATGGTGT
NM_001197122.1      GGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAGAGCTGAGCCCTCGCTCCTCATGGTGT
                    *********************************** ************************

HsCD00435222        GCCTCCAACCCCCCTGTTCCCCACCACCTCAACCAA---
NM_001197122.1      GCCTCCAACCCCCCTGTTCCCCACCACCTCAACCAATAA
                    ************************************   

Pathways

Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cytokine Signaling in Immune system
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Hemostasis
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : LRR FLII-interacting protein 1 (LRRFIP1) activates type I IFN production
Reactome : MyD88-independent cascade
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STING mediated induction of host immune responses
Reactome : TRAF3-dependent IRF activation pathway
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : Apoptosis
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : IRF : interferon regulatory factor
HPRD : 04769

Clone

Original Clone ID : ccsbBroad304_06458

Organism


TAX_ID : 9606
Species Specific ID: 3661

Genome

Chromosome : 19
Map Location : 19q13.3-q13.4
Ensembl : ENSG00000126456

Reagents

Labome : IRF-3-antibody