DNASU Plasmid Repository • 480.965.5697 | Email

TAB1 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TAB1
Gene Name:  TGF-beta activated kinase 1/MAP3K7 binding protein 1
Sequence             
Original Clone ID: ccsbBroad304_02441
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00435935

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1513nts         Open reading frame : 1 to 1513
Reference Sequence Alignment

ATGGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGACAGATGAC
CTGCCTCTCTGCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACTCTGCTGAT
GGCAAGGGCACTGAGAGCCACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGAGTGAGAAC
AACTGCTTCCTGTATGGGGTCTTCAACGGCTATGATGGCAACCGAGTGACCAACTTCGTG
GCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGAATGCCGAGCACGCCGAGGCC
GATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTTCCTGGAGTCC
ATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGGGAGTCCCT
CAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGTTAGAGAGG
GAAATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGCTCTACGTC
GCCAATGTCGGTACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGTTGCAGGTG
ACACAGCTGAACGTGGACCACACCACAGAGAACGAGGATGAGCTCTTCCGTCTTTCGCAG
CTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCATCTGTGGGCAGGAGAGCACC
CGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCTTCTCAGCGCT
GCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGCTGGATGGG
GTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGGCAGCCCAT
GGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTGCCAAGCAG
ACCTCCCTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCATCCACAGCGAC
ACCTTCGCCAGTGGTGGGGAGCGTGCCAGGTTCTGCCCCCGGCACGAGGACATGACCCTG
CTAGTGAGGAACTTTGGCTACCCGCTGGGCGAAATGAGCCAGCCCACACCGAGCCCAGCC
CCAGCTGCAGGAGGACGAGTGTACCCTGTGTCTGTGCCATACTCCAGCGCCCAGAGCACC
AGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAGGGCCAGATGGTCAACGGG
GCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAACCAAAGCCCGACC
TTAACCCTGCAGTCCACCAACACGCACACGCAGAGCAGCAGCTCCAGCTCTGACGGAGGC
CTCTTCCGCTCCCGGCCCGCCCACTCGCTCCCGCCTGGCGAGGACGGTCGTGTTGAGCCC
TATGTGGACTTTGCTGAGTTTTACCGCCTCTGGAGCGTGGACCATGGCGAGCAGAGCGTG
GTGACAGCACCG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TAB1
Symbol Nomenclature : TAB1
SYNONYM : 3'-Tab1; MAP3K7IP1
Designation : TAK1-binding protein 1|TGF-beta-activated kinase 1 and MAP3K7-binding protein 1|mitogen-activated protein kinase kinase kinase 7-interacting protein 1|transforming growth factor beta-activated kinase-binding protein 1
Full Nomenclature : TGF-beta activated kinase 1/MAP3K7 binding protein 1
GENEID : 10454
Locus Tag : RP3-407F17.2
HGNC : 18157
MIM : 602615
Vega : OTTHUMG00000151102
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00435935      ATGGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGACAGATGAC
NM_006116.2       ATGGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGACAGATGAC
                  ************************************************************

HsCD00435935      CTGCCTCTCTGCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACTCTGCTGAT
NM_006116.2       CTGCCTCTCTGCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACTCTGCTGAT
                  ************************************************************

HsCD00435935      GGCAAGGGCACTGAGAGCCACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGAGTGAGAAC
NM_006116.2       GGCAAGGGCACTGAGAGCCACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGAGTGAGAAC
                  ************************************************************

HsCD00435935      AACTGCTTCCTGTATGGGGTCTTCAACGGCTATGATGGCAACCGAGTGACCAACTTCGTG
NM_006116.2       AACTGCTTCCTGTATGGGGTCTTCAACGGCTATGATGGCAACCGAGTGACCAACTTCGTG
                  ************************************************************

HsCD00435935      GCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGAATGCCGAGCACGCCGAGGCC
NM_006116.2       GCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGAATGCCGAGCACGCCGAGGCC
                  ************************************************************

HsCD00435935      GATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTTCCTGGAGTCC
NM_006116.2       GATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTTCCTGGAGTCC
                  ************************************************************

HsCD00435935      ATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGGGAGTCCCT
NM_006116.2       ATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGGGAGTCCCT
                  ************************************************************

HsCD00435935      CAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGTTAGAGAGG
NM_006116.2       CAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGTTAGAGAGG
                  ************************************************************

HsCD00435935      GAAATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGCTCTACGTC
NM_006116.2       GAAATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGCTCTACGTC
                  ************************************************************

HsCD00435935      GCCAATGTCGGTACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGTTGCAGGTG
NM_006116.2       GCCAATGTCGGTACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGTTGCAGGTG
                  ************************************************************

HsCD00435935      ACACAGCTGAACGTGGACCACACCACAGAGAACGAGGATGAGCTCTTCCGTCTTTCGCAG
NM_006116.2       ACACAGCTGAACGTGGACCACACCACAGAGAACGAGGATGAGCTCTTCCGTCTTTCGCAG
                  ************************************************************

HsCD00435935      CTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCATCTGTGGGCAGGAGAGCACC
NM_006116.2       CTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCATCTGTGGGCAGGAGAGCACC
                  ************************************************************

HsCD00435935      CGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCTTCTCAGCGCT
NM_006116.2       CGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCTTCTCAGCGCT
                  ************************************************************

HsCD00435935      GCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGCTGGATGGG
NM_006116.2       GCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGCTGGATGGG
                  ************************************************************

HsCD00435935      GTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGGCAGCCCAT
NM_006116.2       GTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGGCAGCCCAT
                  ************************************************************

HsCD00435935      GGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTGCCAAGCAG
NM_006116.2       GGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTGCCAAGCAG
                  ************************************************************

HsCD00435935      ACCTCCCTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCATCCACAGCGAC
NM_006116.2       ACCTCCCTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCATCCACAGCGAC
                  ************************************************************

HsCD00435935      ACCTTCGCCAGTGGTGGGGAGCGTGCCAGGTTCTGCCCCCGGCACGAGGACATGACCCTG
NM_006116.2       ACCTTCGCCAGTGGTGGGGAGCGTGCCAGGTTCTGCCCCCGGCACGAGGACATGACCCTG
                  ************************************************************

HsCD00435935      CTAGTGAGGAACTTTGGCTACCCGCTGGGCGAAATGAGCCAGCCCACACCGAGCCCAGCC
NM_006116.2       CTAGTGAGGAACTTTGGCTACCCGCTGGGCGAAATGAGCCAGCCCACACCGAGCCCAGCC
                  ************************************************************

HsCD00435935      CCAGCTGCAGGAGGACGAGTGTACCCTGTGTCTGTGCCATACTCCAGCGCCCAGAGCACC
NM_006116.2       CCAGCTGCAGGAGGACGAGTGTACCCTGTGTCTGTGCCATACTCCAGCGCCCAGAGCACC
                  ************************************************************

HsCD00435935      AGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAGGGCCAGATGGTCAACGGG
NM_006116.2       AGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAGGGCCAGATGGTCAACGGG
                  ************************************************************

HsCD00435935      GCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAACCAAAGCCCGACC
NM_006116.2       GCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAACCAAAGCCCGACC
                  ************************************************************

HsCD00435935      TTAACCCTGCAGTCCACCAACACGCACACGCAGAGCAGCAGCTCCAGCTCTGACGGAGGC
NM_006116.2       TTAACCCTGCAGTCCACCAACACGCACACGCAGAGCAGCAGCTCCAGCTCTGACGGAGGC
                  ************************************************************

HsCD00435935      CTCTTCCGCTCCCGGCCCGCCCACTCGCTCCCGCCTGGCGAGGACGGTCGTGTTGAGCCC
NM_006116.2       CTCTTCCGCTCCCGGCCCGCCCACTCGCTCCCGCCTGGCGAGGACGGTCGTGTTGAGCCC
                  ************************************************************

HsCD00435935      TATGTGGACTTTGCTGAGTTTTACCGCCTCTGGAGCGTGGACCATGGCGAGCAGAGCGTG
NM_006116.2       TATGTGGACTTTGCTGAGTTTTACCGCCTCTGGAGCGTGGACCATGGCGAGCAGAGCGTG
                  ************************************************************

HsCD00435935      GTGACAGCACCG---
NM_006116.2       GTGACAGCACCGTAG
                  ************   

Pathways

NCI : BMP receptor signaling
NCI : C-MYB transcription factor network
NCI : IL1-mediated signaling events
NCI : Noncanonical Wnt signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of p38-alpha and p38-beta
NCI : TGF-beta receptor signaling
NCI : TNF receptor signaling pathway
NCI : p38 MAPK signaling pathway
Panther : TGF-beta signaling pathway
Panther : Toll receptor signaling pathway
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signaling by Interleukins
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRAF6 mediated induction of TAK1 complex
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : IL-1 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Original Clone ID : ccsbBroad304_02441

Organism


TAX_ID : 9606
Species Specific ID: 10454

Genome

Chromosome : 22
Map Location : 22q13.1
Ensembl : ENSG00000100324

Reagents

Labome : TAB1-antibody