DNASU Plasmid Repository • 480.965.5697 | Email

LYPLA1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LYPLA1
Gene Name:  lysophospholipase I
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH177735.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 23430251
Title: Large Scale Structural Rearrangement of a Serine Hydrolase from Francisella tularensis Facilitates Catalysis
Authors: HIP
HsCD00043610

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 693nts         Open reading frame : 1 to 693
Reference Sequence Alignment

ATGTGCGGCAATAACATGTCAACCCCGCTGCCCGCCATCGTGCCCGCCGCCCGGAAGGCC
ACCGCTGCGGTGATTTTCCTGCATGGATTGGGAGATACTGGGCACGGATGGGCAGAAGCC
TTTGCAGGTATCAGAAGTTCACATATCAAATATATCTGCCCGCATGCGCCTGTTAGGCCT
GTTACATTAAATATGAACGTGGCTATGCCTTCATGGTTTGATATTATTGGGCTTTCACCA
GATTCACAGGAGGATGAATCTGGGATTAAACAGGCAGCAGAAAATATAAAAGCTTTGATT
GATCAAGAAGTGAAGAATGGCATTCCTTCTAACAGAATTATTTTGGGAGGGTTTTCTCAG
GGAGGAGCTTTATCTTTATATACTGCCCTTACCACACAGCAGAAACTGGCAGGTGTCACT
GCACTCAGTTGCTGGCTTCCACTTCGGGCTTCCTTTCCACAGGGTCCTATCGGTGGTGCT
AATAGAGATATTTCTATTCTCCAGTGCCACGGGGATTGTGACCCTTTGGTTCCCCTGATG
TTTGGTTCTCTTACGGTGGAAAAACTAAAAACATTGGTGAATCCAGCCAATGTGACCTTT
AAAACCTATGAAGGTATGATGCACAGTTCGTGTCAACAGGAAATGATGGATGTCAAGCAA
TTCATTGATAAACTCCTACCTCCAATTGATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 787
Start on reference sequence 95
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LYPLA1
Symbol Nomenclature : LYPLA1
SYNONYM : APT-1; APT1; LPL-I; LPL1; hAPT1
Designation : acyl-protein thioesterase 1|lysoPLA I|lysophospholipid-specific lysophospholipase
Full Nomenclature : lysophospholipase I
GENEID : 10434
HGNC : 6737
MIM : 605599
Vega : OTTHUMG00000164313
Target GenBank: BC008652

 

Reference Sequence Alignment

  

HsCD00043610        ATGTGCGGCAATAACATGTCAACCCCGCTGCCCGCCATCGTGCCCGCCGCCCGGAAGGCC
NM_001279358.1      ATGTGCGGCAATAACATGTCAACCCCGCTGCCCGCCATCGTGCCCGCCGCCCGGAAGGCC
NM_001279357.1      ATGTGCGGCAATAACATGTCAACCCCGCTGCCCGCCATCGTGCCCGCCGCCCGGAAGGCC
NM_006330.3         ATGTGCGGCAATAACATGTCAACCCCGCTGCCCGCCATCGTGCCCGCCGCCCGGAAGGCC
                    ************************************************************

HsCD00043610        ACCGCTGCGGTGATTTTCCTGCATGGATTGGGAGATACTGGGCACGGATGGGCAGAAGCC
NM_001279358.1      ACCGCTGCGGTGATTTTCCTGCATGGATTGGGAGATACTGGGCACGGATGGGCAGAAGCC
NM_001279357.1      ACCGCTGCGGTGATTTTCCTGCATGGATTGGGAGATACTGGGCACGGATGGGCAGAAGCC
NM_006330.3         ACCGCTGCGGTGATTTTCCTGCATGGATTGGGAGATACTGGGCACGGATGGGCAGAAGCC
                    ************************************************************

HsCD00043610        TTTGCAGGTATCAGAAGTTCACATATCAAATATATCTGCCCGCATGCGCCTGTTAGGCCT
NM_001279358.1      TTTGCAGGTATCAGAAGTTCACATATCAAATATATCTGCCCGCATGCGCCTGTTAGGCCT
NM_001279357.1      TTTGCAGGTATCAGAAGTTCACATATCAAATATATCTGCCCGCATGCGTTTG--------
NM_006330.3         TTTGCAGGTATCAGAAGTTCACATATCAAATATATCTGCCCGCATGCGCCTGTTAGGCCT
                    ************************************************  **        

HsCD00043610        GTTACATTAAATATGAACGTGGCTATGCCTTCATGGTTTGATATTATTGGGCTTTCACCA
NM_001279358.1      GTTACATTAAATATGAACGTGGCTATGCCTTCATGGTTTGATATTATTGGGCTTTCACCA
NM_001279357.1      ----------------------------------------ATATTATTGGGCTTTCACCA
NM_006330.3         GTTACATTAAATATGAACGTGGCTATGCCTTCATGGTTTGATATTATTGGGCTTTCACCA
                                                            ********************

HsCD00043610        GATTCACAGGAGGATGAATCTGGGATTAAACAGGCAGCAGAAAATATAAAAGCTTTGATT
NM_001279358.1      GATTCACAGGAGGATGAATCTGGGATTAAACAGGCAGCAGAAAATATAAAAGCTTTGATT
NM_001279357.1      GATTCACAGGAGGATGAATCTGGGATTAAACAGGCAGCAGAAAATATAAAAGCTTTGATT
NM_006330.3         GATTCACAGGAGGATGAATCTGGGATTAAACAGGCAGCAGAAAATATAAAAGCTTTGATT
                    ************************************************************

HsCD00043610        GATCAAGAAGTGAAGAATGGCATTCCTTCTAACAGAATTATTTTGGGAGGGTTTTCTCAG
NM_001279358.1      GATCAAGAAGTGAAGAATGGCATTCCTTCTAACAGAATTATTTTGGGAGGGTTTTCTCAG
NM_001279357.1      GATCAAGAAGTGAAGAATGGCATTCCTTCTAACAGAATTATTTTGGGAGGGTTTTCTCAG
NM_006330.3         GATCAAGAAGTGAAGAATGGCATTCCTTCTAACAGAATTATTTTGGGAGGGTTTTCTCAG
                    ************************************************************

HsCD00043610        GGAGGAGCTTTATCTTTATATACTGCCCTTACCACACAGCAGAAACTGGCAGGTGTCACT
NM_001279358.1      GGAGGAGCTTTATCTTTATATACTGCCCTTACCACACAGCAGAAACTGGCAGGTGTCACT
NM_001279357.1      GGAGGAGCTTTATCTTTATATACTGCCCTTACCACACAGCAGAAACTGGCAGGTGTCACT
NM_006330.3         GGAGGAGCTTTATCTTTATATACTGCCCTTACCACACAGCAGAAACTGGCAGGTGTCACT
                    ************************************************************

HsCD00043610        GCACTCAGTTGCTGGCTTCCACTTCGGGCTTCCTTTCCACAGGGTCCTATCGGTGGTGCT
NM_001279358.1      GCACTCAGTTGCTGGCTTCCACTTCGGGCTTCCTTTCCACAG------------------
NM_001279357.1      GCACTCAGTTGCTGGCTTCCACTTCGGGCTTCCTTTCCACAGGGTCCTATCGGTGGTGCT
NM_006330.3         GCACTCAGTTGCTGGCTTCCACTTCGGGCTTCCTTTCCACAGGGTCCTATCGGTGGTGCT
                    ******************************************                  

HsCD00043610        AATAGAGATATTTCTATTCTCCAGTGCCACGGGGATTGTGACCCTTTGGTTCCCCTGATG
NM_001279358.1      ------------------------TGCCACGGGGATTGTGACCCTTTGGTTCCCCTGATG
NM_001279357.1      AATAGAGATATTTCTATTCTCCAGTGCCACGGGGATTGTGACCCTTTGGTTCCCCTGATG
NM_006330.3         AATAGAGATATTTCTATTCTCCAGTGCCACGGGGATTGTGACCCTTTGGTTCCCCTGATG
                                            ************************************

HsCD00043610        TTTGGTTCTCTTACGGTGGAAAAACTAAAAACATTGGTGAATCCAGCCAATGTGACCTTT
NM_001279358.1      TTTGGTTCTCTTACGGTGGAAAAACTAAAAACATTGGTGAATCCAGCCAATGTGACCTTT
NM_001279357.1      TTTGGTTCTCTTACGGTGGAAAAACTAAAAACATTGGTGAATCCAGCCAATGTGACCTTT
NM_006330.3         TTTGGTTCTCTTACGGTGGAAAAACTAAAAACATTGGTGAATCCAGCCAATGTGACCTTT
                    ************************************************************

HsCD00043610        AAAACCTATGAAGGTATGATGCACAGTTCGTGTCAACAGGAAATGATGGATGTCAAGCAA
NM_001279358.1      AAAACCTATGAAGGTATGATGCACAGTTCGTGTCAACAGGAAATGATGGATGTCAAGCAA
NM_001279357.1      AAAACCTATGAAGGTATGATGCACAGTTCGTGTCAACAGGAAATGATGGATGTCAAGCAA
NM_006330.3         AAAACCTATGAAGGTATGATGCACAGTTCGTGTCAACAGGAAATGATGGATGTCAAGCAA
                    ************************************************************

HsCD00043610        TTCATTGATAAACTCCTACCTCCAATTGATTAG
NM_001279358.1      TTCATTGATAAACTCCTACCTCCAATTGATTGA
NM_001279357.1      TTCATTGATAAACTCCTACCTCCAATTGATTGA
NM_006330.3         TTCATTGATAAACTCCTACCTCCAATTGATTGA
                    *******************************..

Pathways

Reactome : Metabolism
Reactome : Metabolism of nitric oxide
Reactome : eNOS activation
Reactome : eNOS activation and regulation

Protein

UniProt : Q6IAQ1
UniProt : O75608
HPRD : 07063

Clone

Cloning Information : 177735
HIP Master Clone ID : 152880
Original Clone ID : FLH177735.01X

Organism


TAX_ID : 9606
Species Specific ID: 10434

Genome

Chromosome : 8
Map Location : 8q11.23
Ensembl : ENSG00000120992

Reagents

Labome : LYPLA1-antibody