DNASU Plasmid Repository • 480.965.5697 | Email

NBN (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NBN
Gene Name:  nibrin
Sequence             
Original Clone ID: ccsbBroad304_06618
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00437042

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2263nts         Open reading frame : 1 to 2263
Reference Sequence Alignment

ATGTGGAAACTGCTGCCCGCCGCGGGCCCGGCAGGAGGAGAACCATACAGACTTTTGACT
GGCGTTGAGTACGTTGTTGGAAGGAAAAACTGTGCCATTCTAATTGAAAATGATCAGTCG
ATCAGCCGAAATCATGCTGTGTTAACTGCTAACTTTTCTGTAACCAACCTGAGTCAAACA
GATGAAATCCCTGTATTGACATTAAAAGATAATTCTAAGTATGGTACCTTTGTTAATGAG
GAAAAAATGCAGAATGGCTTTTCCCGAACTTTGAAGTCGGGGGATGGTATTACTTTTGGA
GTGTTTGGAAGTAAATTCAGAATAGAGTATGAGCCTTTGGTTGCATGCTCTTCTTGTTTA
GATGTCTCTGGGAAAACTGCTTTAAATCAAGCTATATTGCAACTTGGAGGATTTACTGTA
AACAATTGGACAGAAGAATGCACTCACCTTGTCATGGTATCAGTGAAAGTTACCATTAAA
ACAATATGTGCACTCATTTGTGGACGTCCAATTGTAAAGCCAGAATATTTTACTGAATTC
CTGAAAGCAGTTCAGTCCAAGAAGCAGCCTCCACAAATTGAAAGTTTTTACCCACCTCTT
GATGAACCATCTATTGGAAGTAAAAATGTTGATCTGTCAGGACGGCAGGAAAGAAAACAA
ATCTTCAAAGGGAAAACATTTATATTTTTGAATGCCAAACAGCATAAGAAATTGAGTTCC
GCAGTTGTCTTTGGAGGTGGGGAAGCTAGGTTGATAACAGAAGAGAATGAAGAAGAACAT
AATTTCTTTTTGGCTCCGGGAACGTGTGTTGTTGATACAGGAATAACAAACTCACAGACC
TTAATTCCTGACTGTCAGAAGAAATGGATTCAGTCAATAATGGATATGCTCCAAAGGCAA
GGTCTTAGACCTATTCCTGAAGCAGAAATTGGATTGGCGGTGATTTTCATGACTACAAAG
AATTACTGTGATCTTCAGGGCCATCCCAGTACAGGATTAAAGACAACAACTCCAGGACCA
AGCCTTTCACAAGGCGTGTCAGTTGATGAAAAACTAATGCCAAGCGCCCCAGTGAACACT
ACAACATACGTAGCTGACACAGAATCAGAGCAAGCAGATACATGGGATTTGAGTGAAAGG
CCAAAAGAAATCAAAGTCTCCAAAATGGAACAAAAATTCAGAATGCTTTCACAAGACGCA
CCCACTGTAAAGGAGTCCTGCAAAACAAGCTCTAATAATAATAGTATGGTATCAAATACT
TTGGCTAAGATGAGAATCCCAAACTATCAGCTTTCACCAACTAAATTGCCAAGTATAAAT
AAAAGTAAAGATAGGGCTTCTCAGCAGCAGCAGACCAACTCCATCAGAAACTACTTTCAG
CCGTCTACCAAAAAAAGGGAAAGGGATGAAGAAAATCAAGAAATGTCTTCATGCAAATCA
GCAAGAATAGAAACGTCTTGTTCTCTTTTAGAACAAACACAACCTGCTACACCCTCATTG
TGGAAAAATAAGGAGCAGCATCTATCTGAGAATGAGCCTGTGGACACAAACTCAGACAAT
AACTTATTTACAGATACAGATTTAAAATCTATTGTGAAAAATTCTGCCAGTAAATCTCAT
GCTGCAGAAAAGCTAAGATCAAATAAAAAAAGGGAAATGGATGATGTGGCCATAGAAGAT
GAAGTATTGGAACAGTTATTCAAGGACACAAAACCAGAGTTAGAAATTGATGTGAAAGTT
CAAAAACAGGAGGAAGATGTCAATGTTAGAAAAAGGCCAAGGATGGATATAGAAACAAAT
GACACTTTCAGTGATGAAGCAGTACCAGAAAGTAGCAAAATATCTCAAGAAAATGAAATT
GGGAAGAAACGTGAACTCAAGGAAGACTCACTATGGTCAGCTAAAGAAATATCTAACAAT
GACAAACTTCAGGATGATAGTGAGATGCTTCCAAAAAAGCTGTTATTGACTGAATTTAGA
TCACTGGTGATTAAAAACTCTACTTCCAGAAATCCGTCTGGCATAAATGATGATTATGGT
CAACTAAAAAATTTCAAGAAATTCAAAAAGGTCACATATCCTGGAGCAGGAAAACTTCCA
CACATCATTGGAGGATCAGATCTAATAGCTCATCATGCTCGAAAGAATACAGAACTAGAA
GAGTGGCTAAGGCAGGAAATGGAGGTACAAAATCAACATGCAAAAGAAGAGTCTCTTGCT
GATGATCTTTTTAGATACAATCCTTATTTAAAAAGGAGAAGA


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
>4 errors; 2 non-synonomous errors
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NBN
Symbol Nomenclature : NBN
SYNONYM : AT-V1; AT-V2; ATV; NBS; NBS1; P95
Designation : Nijmegen breakage syndrome 1 (nibrin)|cell cycle regulatory protein p95|p95 protein of the MRE11/RAD50 complex
Full Nomenclature : nibrin
GENEID : 4683
HGNC : 7652
MIM : 602667
Vega : OTTHUMG00000153546
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00437042      ATGTGGAAACTGCTGCCCGCCGCGGGCCCGGCAGGAGGAGAACCATACAGACTTTTGACT
NM_002485.4       ATGTGGAAACTGCTGCCCGCCGCGGGCCCGGCAGGAGGAGAACCATACAGACTTTTGACT
                  ************************************************************

HsCD00437042      GGCGTTGAGTACGTTGTTGGAAGGAAAAACTGTGCCATTCTAATTGAAAATGATCAGTCG
NM_002485.4       GGCGTTGAGTACGTTGTTGGAAGGAAAAACTGTGCCATTCTGATTGAAAATGATCAGTCG
                  *****************************************.******************

HsCD00437042      ATCAGCCGAAATCATGCTGTGTTAACTGCTAACTTTTCTGTAACCAACCTGAGTCAAACA
NM_002485.4       ATCAGCCGAAATCATGCTGTGTTAACTGCTAACTTTTCTGTAACCAACCTGAGTCAAACA
                  ************************************************************

HsCD00437042      GATGAAATCCCTGTATTGACATTAAAAGATAATTCTAAGTATGGTACCTTTGTTAATGAG
NM_002485.4       GATGAAATCCCTGTATTGACATTAAAAGATAATTCTAAGTATGGTACCTTTGTTAATGAG
                  ************************************************************

HsCD00437042      GAAAAAATGCAGAATGGCTTTTCCCGAACTTTGAAGTCGGGGGATGGTATTACTTTTGGA
NM_002485.4       GAAAAAATGCAGAATGGCTTTTCCCGAACTTTGAAGTCGGGGGATGGTATTACTTTTGGA
                  ************************************************************

HsCD00437042      GTGTTTGGAAGTAAATTCAGAATAGAGTATGAGCCTTTGGTTGCATGCTCTTCTTGTTTA
NM_002485.4       GTGTTTGGAAGTAAATTCAGAATAGAGTATGAGCCTTTGGTTGCATGCTCTTCTTGTTTA
                  ************************************************************

HsCD00437042      GATGTCTCTGGGAAAACTGCTTTAAATCAAGCTATATTGCAACTTGGAGGATTTACTGTA
NM_002485.4       GATGTCTCTGGGAAAACTGCTTTAAATCAAGCTATATTGCAACTTGGAGGATTTACTGTA
                  ************************************************************

HsCD00437042      AACAATTGGACAGAAGAATGCACTCACCTTGTCATGGTATCAGTGAAAGTTACCATTAAA
NM_002485.4       AACAATTGGACAGAAGAATGCACTCACCTTGTCATGGTATCAGTGAAAGTTACCATTAAA
                  ************************************************************

HsCD00437042      ACAATATGTGCACTCATTTGTGGACGTCCAATTGTAAAGCCAGAATATTTTACTGAATTC
NM_002485.4       ACAATATGTGCACTCATTTGTGGACGTCCAATTGTAAAGCCAGAATATTTTACTGAATTC
                  ************************************************************

HsCD00437042      CTGAAAGCAGTTCAGTCCAAGAAGCAGCCTCCACAAATTGAAAGTTTTTACCCACCTCTT
NM_002485.4       CTGAAAGCAGTTGAGTCCAAGAAGCAGCCTCCACAAATTGAAAGTTTTTACCCACCTCTT
                  ************ ***********************************************

HsCD00437042      GATGAACCATCTATTGGAAGTAAAAATGTTGATCTGTCAGGACGGCAGGAAAGAAAACAA
NM_002485.4       GATGAACCATCTATTGGAAGTAAAAATGTTGATCTGTCAGGACGGCAGGAAAGAAAACAA
                  ************************************************************

HsCD00437042      ATCTTCAAAGGGAAAACATTTATATTTTTGAATGCCAAACAGCATAAGAAATTGAGTTCC
NM_002485.4       ATCTTCAAAGGGAAAACATTTATATTTTTGAATGCCAAACAGCATAAGAAATTGAGTTCC
                  ************************************************************

HsCD00437042      GCAGTTGTCTTTGGAGGTGGGGAAGCTAGGTTGATAACAGAAGAGAATGAAGAAGAACAT
NM_002485.4       GCAGTTGTCTTTGGAGGTGGGGAAGCTAGGTTGATAACAGAAGAGAATGAAGAAGAACAT
                  ************************************************************

HsCD00437042      AATTTCTTTTTGGCTCCGGGAACGTGTGTTGTTGATACAGGAATAACAAACTCACAGACC
NM_002485.4       AATTTCTTTTTGGCTCCGGGAACGTGTGTTGTTGATACAGGAATAACAAACTCACAGACC
                  ************************************************************

HsCD00437042      TTAATTCCTGACTGTCAGAAGAAATGGATTCAGTCAATAATGGATATGCTCCAAAGGCAA
NM_002485.4       TTAATTCCTGACTGTCAGAAGAAATGGATTCAGTCAATAATGGATATGCTCCAAAGGCAA
                  ************************************************************

HsCD00437042      GGTCTTAGACCTATTCCTGAAGCAGAAATTGGATTGGCGGTGATTTTCATGACTACAAAG
NM_002485.4       GGTCTTAGACCTATTCCTGAAGCAGAAATTGGATTGGCGGTGATTTTCATGACTACAAAG
                  ************************************************************

HsCD00437042      AATTACTGTGATCTTCAGGGCCATCCCAGTACAGGATTAAAGACAACAACTCCAGGACCA
NM_002485.4       AATTACTGTGATCCTCAGGGCCATCCCAGTACAGGATTAAAGACAACAACTCCAGGACCA
                  ************* **********************************************

HsCD00437042      AGCCTTTCACAAGGCGTGTCAGTTGATGAAAAACTAATGCCAAGCGCCCCAGTGAACACT
NM_002485.4       AGCCTTTCACAAGGCGTGTCAGTTGATGAAAAACTAATGCCAAGCGCCCCAGTGAACACT
                  ************************************************************

HsCD00437042      ACAACATACGTAGCTGACACAGAATCAGAGCAAGCAGATACATGGGATTTGAGTGAAAGG
NM_002485.4       ACAACATACGTAGCTGACACAGAATCAGAGCAAGCAGATACATGGGATTTGAGTGAAAGG
                  ************************************************************

HsCD00437042      CCAAAAGAAATCAAAGTCTCCAAAATGGAACAAAAATTCAGAATGCTTTCACAAGACGCA
NM_002485.4       CCAAAAGAAATCAAAGTCTCCAAAATGGAACAAAAATTCAGAATGCTTTCACAAGATGCA
                  ******************************************************** ***

HsCD00437042      CCCACTGTAAAGGAGTCCTGCAAAACAAGCTCTAATAATAATAGTATGGTATCAAATACT
NM_002485.4       CCCACTGTAAAGGAGTCCTGCAAAACAAGCTCTAATAATAATAGTATGGTATCAAATACT
                  ************************************************************

HsCD00437042      TTGGCTAAGATGAGAATCCCAAACTATCAGCTTTCACCAACTAAATTGCCAAGTATAAAT
NM_002485.4       TTGGCTAAGATGAGAATCCCAAACTATCAGCTTTCACCAACTAAATTGCCAAGTATAAAT
                  ************************************************************

HsCD00437042      AAAAGTAAAGATAGGGCTTCTCAGCAGCAGCAGACCAACTCCATCAGAAACTACTTTCAG
NM_002485.4       AAAAGTAAAGATAGGGCTTCTCAGCAGCAGCAGACCAACTCCATCAGAAACTACTTTCAG
                  ************************************************************

HsCD00437042      CCGTCTACCAAAAAAAGGGAAAGGGATGAAGAAAATCAAGAAATGTCTTCATGCAAATCA
NM_002485.4       CCGTCTACCAAAAAAAGGGAAAGGGATGAAGAAAATCAAGAAATGTCTTCATGCAAATCA
                  ************************************************************

HsCD00437042      GCAAGAATAGAAACGTCTTGTTCTCTTTTAGAACAAACACAACCTGCTACACCCTCATTG
NM_002485.4       GCAAGAATAGAAACGTCTTGTTCTCTTTTAGAACAAACACAACCTGCTACACCCTCATTG
                  ************************************************************

HsCD00437042      TGGAAAAATAAGGAGCAGCATCTATCTGAGAATGAGCCTGTGGACACAAACTCAGACAAT
NM_002485.4       TGGAAAAATAAGGAGCAGCATCTATCTGAGAATGAGCCTGTGGACACAAACTCAGACAAT
                  ************************************************************

HsCD00437042      AACTTATTTACAGATACAGATTTAAAATCTATTGTGAAAAATTCTGCCAGTAAATCTCAT
NM_002485.4       AACTTATTTACAGATACAGATTTAAAATCTATTGTGAAAAATTCTGCCAGTAAATCTCAT
                  ************************************************************

HsCD00437042      GCTGCAGAAAAGCTAAGATCAAATAAAAAAAGGGAAATGGATGATGTGGCCATAGAAGAT
NM_002485.4       GCTGCAGAAAAGCTAAGATCAAATAAAAAAAGGGAAATGGATGATGTGGCCATAGAAGAT
                  ************************************************************

HsCD00437042      GAAGTATTGGAACAGTTATTCAAGGACACAAAACCAGAGTTAGAAATTGATGTGAAAGTT
NM_002485.4       GAAGTATTGGAACAGTTATTCAAGGACACAAAACCAGAGTTAGAAATTGATGTGAAAGTT
                  ************************************************************

HsCD00437042      CAAAAACAGGAGGAAGATGTCAATGTTAGAAAAAGGCCAAGGATGGATATAGAAACAAAT
NM_002485.4       CAAAAACAGGAGGAAGATGTCAATGTTAGAAAAAGGCCAAGGATGGATATAGAAACAAAT
                  ************************************************************

HsCD00437042      GACACTTTCAGTGATGAAGCAGTACCAGAAAGTAGCAAAATATCTCAAGAAAATGAAATT
NM_002485.4       GACACTTTCAGTGATGAAGCAGTACCAGAAAGTAGCAAAATATCTCAAGAAAATGAAATT
                  ************************************************************

HsCD00437042      GGGAAGAAACGTGAACTCAAGGAAGACTCACTATGGTCAGCTAAAGAAATATCTAACAAT
NM_002485.4       GGGAAGAAACGTGAACTCAAGGAAGACTCACTATGGTCAGCTAAAGAAATATCTAACAAT
                  ************************************************************

HsCD00437042      GACAAACTTCAGGATGATAGTGAGATGCTTCCAAAAAAGCTGTTATTGACTGAATTTAGA
NM_002485.4       GACAAACTTCAGGATGATAGTGAGATGCTTCCAAAAAAGCTGTTATTGACTGAATTTAGA
                  ************************************************************

HsCD00437042      TCACTGGTGATTAAAAACTCTACTTCCAGAAATCCGTCTGGCATAAATGATGATTATGGT
NM_002485.4       TCACTGGTGATTAAAAACTCTACTTCCAGAAATCCATCTGGCATAAATGATGATTATGGT
                  ***********************************.************************

HsCD00437042      CAACTAAAAAATTTCAAGAAATTCAAAAAGGTCACATATCCTGGAGCAGGAAAACTTCCA
NM_002485.4       CAACTAAAAAATTTCAAGAAATTCAAAAAGGTCACATATCCTGGAGCAGGAAAACTTCCA
                  ************************************************************

HsCD00437042      CACATCATTGGAGGATCAGATCTAATAGCTCATCATGCTCGAAAGAATACAGAACTAGAA
NM_002485.4       CACATCATTGGAGGATCAGATCTAATAGCTCATCATGCTCGAAAGAATACAGAACTAGAA
                  ************************************************************

HsCD00437042      GAGTGGCTAAGGCAGGAAATGGAGGTACAAAATCAACATGCAAAAGAAGAGTCTCTTGCT
NM_002485.4       GAGTGGCTAAGGCAGGAAATGGAGGTACAAAATCAACATGCAAAAGAAGAGTCTCTTGCT
                  ************************************************************

HsCD00437042      GATGATCTTTTTAGATACAATCCTTATTTAAAAAGGAGAAGA---
NM_002485.4       GATGATCTTTTTAGATACAATCCTTATTTAAAAAGGAGAAGATAA
                  ******************************************   

Pathways

NCI : ATM pathway
NCI : ATR signaling pathway
NCI : BARD1 signaling events
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated targets of C-MYC transcriptional activation
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Assembly of the RAD50-MRE11-NBS1 complex at DNA double-strand breaks
Reactome : Cell Cycle
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : MRN complex relocalizes to nuclear foci
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
WikiPathway : DNA damage response
WikiPathway : Homologous recombination
WikiPathway : miRNA regulation of DNA Damage Response

Protein

SMART domain : FHA : Forkhead associated domain
HPRD : 04050

Clone

Original Clone ID : ccsbBroad304_06618

Organism


TAX_ID : 9606
Species Specific ID: 4683

Genome

Chromosome : 8
Map Location : 8q21
Ensembl : ENSG00000104320

Reagents

Labome : Nbs1-antibody