DNASU Plasmid Repository • 480.965.5697 | Email

TNF (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TNF
Gene Name:  tumor necrosis factor
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH179071.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00043745

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 702nts         Open reading frame : 1 to 702
Reference Sequence Alignment

ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG
ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC
GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG
GAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCT
TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGG
CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA
GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC
AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC
GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG
ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC
CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT
GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 859
Start on reference sequence 158
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TNF
Symbol Nomenclature : TNF
SYNONYM : DIF; TNF-alpha; TNFA; TNFSF2
Designation : APC1 protein|TNF, macrophage-derived|TNF, monocyte-derived|TNF-a|cachectin|tumor necrosis factor ligand superfamily member 2|tumor necrosis factor-alpha
Full Nomenclature : tumor necrosis factor
GENEID : 7124
Locus Tag : DADB-70P7.1
HGNC : 11892
MIM : 191160
Vega : OTTHUMG00000031194
Target GenBank: BC028148

 

Reference Sequence Alignment

  

HsCD00043745      ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG
NM_000594.3       ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG
                  ************************************************************

HsCD00043745      ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC
NM_000594.3       ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC
                  ************************************************************

HsCD00043745      GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG
NM_000594.3       GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG
                  ************************************************************

HsCD00043745      GAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCT
NM_000594.3       GAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCT
                  ************************************************************

HsCD00043745      TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGG
NM_000594.3       TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGG
                  ************************************************************

HsCD00043745      CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA
NM_000594.3       CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA
                  ************************************************************

HsCD00043745      GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC
NM_000594.3       GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC
                  ************************************************************

HsCD00043745      AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC
NM_000594.3       AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC
                  ************************************************************

HsCD00043745      GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG
NM_000594.3       GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG
                  ************************************************************

HsCD00043745      ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC
NM_000594.3       ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC
                  ************************************************************

HsCD00043745      CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT
NM_000594.3       CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT
                  ************************************************************

HsCD00043745      GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTAG
NM_000594.3       GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTGA
                  ****************************************..

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Canonical NF-kappaB pathway
NCI : Caspase Cascade in Apoptosis
NCI : Cellular roles of Anthrax toxin
NCI : Ceramide signaling pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : IL23-mediated signaling events
NCI : IL27-mediated signaling events
NCI : RXR and RAR heterodimerization with other nuclear receptor
NCI : Signaling events mediated by HDAC Class I
NCI : TNF receptor signaling pathway
NCI : amb2 Integrin signaling
Panther : Apoptosis signaling pathway
Panther : Wnt signaling pathway
Reactome : Apoptosis
Reactome : Death Receptor Signalling
Reactome : Developmental Biology
Reactome : Extrinsic Pathway for Apoptosis
Reactome : TNF signaling
Reactome : Transcriptional regulation of white adipocyte differentiation
WikiPathway : Adipogenesis
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Cytokines and Inflammatory Response
WikiPathway : EBV LMP1 signaling
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : Folate Metabolism
WikiPathway : MAPK signaling pathway
WikiPathway : Matrix Metalloproteinases
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Monoamine Transport
WikiPathway : Notch Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : Selenium Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Type II diabetes mellitus
WikiPathway : Vitamin B12 Metabolism

Protein

SMART domain : TNF : Tumour necrosis factor family.
UniProt : P01375
UniProt : Q5STB3
UniProt : C1K3N5
HPRD : 01855

Clone

Cloning Information : 179071
HIP Master Clone ID : 154172
Original Clone ID : FLH179071.01X

Organism


TAX_ID : 9606
Species Specific ID: 7124

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000232810

Reagents

Labome : TNF-alpha-antibody