DNASU Plasmid Repository • 480.965.5697 | Email

RPA3 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPA3
Gene Name:  replication protein A3, 14kDa
Sequence             
Original Clone ID: ccsbBroad304_13945
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00437663

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 363nts         Open reading frame : 1 to 363
Reference Sequence Alignment

ATGGTGGACATATGGACTTGCCCAGGTCGCGCATCAACGCCGGCATGCTAGCTCAATTCA
TCGACAAGCCTGTCTGCTTCGTAGGGAGGCTGGAAAAGATTCATCCCACCGGAAAAATGT
TTATTCTTTCAGATGGAGAAGGAAAAAATGGAACCATCGAGTTGATGGAACCCCTTGATG
AAGAAATCTCTGGAATTGTGGAAGTGGTTGGAAGAGTAACCGCCAAGGCCACCATCTTGT
GTACATCTTATGTCCAGTTTAAAGAAGATAGCCATCCTTTTGATCTTGGACTTTACAATG
AAGCTGTGAAAATTATCCATGACTTCCCTCAGTTTTATCCTTTAGGGATTGTGCAACATG
AT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
>4 errors; >4 non-synonomous errors;
 early stop codon; insertion or deletion in coding sequence
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPA3
Symbol Nomenclature : RPA3
SYNONYM : REPA3
Designation : RF-A protein 3|RP-A p14|replication factor A protein 3|replication protein A 14 kDa subunit
Full Nomenclature : replication protein A3, 14kDa
GENEID : 6119
HGNC : 10291
MIM : 179837
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00437663      -ATGGTGGACATATGGACTTGCCCAGGTCGCGCATCAACGCCGGCATGCTAGCTCAATTC
NM_002947.3       ATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAACGCCGGCATGCTAGCTCAATTC
                   : *  *...: ************************************************

HsCD00437663      ATCGACAAGCCTGTCTGCTTCGTAGGGAGGCTGGAAAAGATTCATCCCACCGGAAAAATG
NM_002947.3       ATCGACAAGCCTGTCTGCTTCGTAGGGAGGCTGGAAAAGATTCATCCCACCGGAAAAATG
                  ************************************************************

HsCD00437663      TTTATTCTTTCAGATGGAGAAGGAAAAAATGGAACCATCGAGTTGATGGAACCCCTTGAT
NM_002947.3       TTTATTCTTTCAGATGGAGAAGGAAAAAATGGAACCATCGAGTTGATGGAACCCCTTGAT
                  ************************************************************

HsCD00437663      GAAGAAATCTCTGGAATTGTGGAAGTGGTTGGAAGAGTAACCGCCAAGGCCACCATCTTG
NM_002947.3       GAAGAAATCTCTGGAATTGTGGAAGTGGTTGGAAGAGTAACCGCCAAGGCCACCATCTTG
                  ************************************************************

HsCD00437663      TGTACATCTTATGTCCAGTTTAAAGAAGATAGCCATCCTTTTGATCTTGGACTTTACAAT
NM_002947.3       TGTACATCTTATGTCCAGTTTAAAGAAGATAGCCATCCTTTTGATCTTGGACTTTACAAT
                  ************************************************************

HsCD00437663      GAAGCTGTGAAAATTATCCATGACTTCCCTCAGTTTTATCCTTTAGGGATTGTGCAACAT
NM_002947.3       GAAGCTGTGAAAATTATCCATGACTTCCCTCAGTTTTATCCTTTAGGGATTGTGCAACAT
                  ************************************************************

HsCD00437663      GAT---
NM_002947.3       GATTGA
                  ***   

Pathways

Panther : Cell cycle
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : Double-Strand Break Repair
Reactome : Dual incision reaction in GG-NER
Reactome : Extension of Telomeres
Reactome : Formation of incision complex in GG-NER
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : HSF1 activation
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Lagging Strand Synthesis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Nucleotide Excision Repair
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
Reactome : Processing of DNA double-strand break ends
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication
WikiPathway : G1 to S cell cycle control

Protein

HPRD : 01567

Clone

Original Clone ID : ccsbBroad304_13945

Organism


TAX_ID : 9606
Species Specific ID: 6119

Genome

Chromosome : 7
Map Location : 7p22

Reagents

Labome : RPA3-antibody