DNASU Plasmid Repository • 480.965.5697 | Email

H2AFX (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  H2AFX
Gene Name:  H2A histone family, member X
Sequence             
Original Clone ID: ccsbBroad304_00717
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 26667181
Title: A comprehensive analysis of radiosensitization targets; functional inhibition of DNA methyltransferase 3B radiosensitizes by disrupting DNA damage regulation
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00437738

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 430nts         Open reading frame : 1 to 430
Reference Sequence Alignment

ATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCG
CGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTAC
GCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACC
GCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATC
CCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGC
GTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAG
ACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCC
CAGGAGTAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : H2AFX
Symbol Nomenclature : H2AFX
SYNONYM : H2A.X; H2A/X; H2AX
Designation : H2AX histone|histone H2A.x|histone H2AX
Full Nomenclature : H2A histone family, member X
GENEID : 3014
HGNC : 4739
MIM : 601772
Vega : OTTHUMG00000166196
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00437738      ATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCG
NM_002105.2       ATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCG
                  ************************************************************

HsCD00437738      CGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTAC
NM_002105.2       CGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTAC
                  ************************************************************

HsCD00437738      GCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACC
NM_002105.2       GCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACC
                  ************************************************************

HsCD00437738      GCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATC
NM_002105.2       GCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATC
                  ************************************************************

HsCD00437738      CCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGC
NM_002105.2       CCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGC
                  ************************************************************

HsCD00437738      GTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAG
NM_002105.2       GTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAG
                  ************************************************************

HsCD00437738      ACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCC
NM_002105.2       ACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCC
                  ************************************************************

HsCD00437738      CAGGAGTAC---
NM_002105.2       CAGGAGTACTAA
                  *********   

Pathways

NCI : ATM pathway
NCI : Fanconi anemia pathway
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Amyloids
Reactome : Assembly of the RAD50-MRE11-NBS1 complex at DNA double-strand breaks
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : Condensation of Prophase Chromosomes
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Deposition of new CENPA-containing nucleosomes at the centromere
Reactome : Disease
Reactome : Double-Strand Break Repair
Reactome : Epigenetic regulation of gene expression
Reactome : Gene Expression
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : M Phase
Reactome : MRN complex relocalizes to nuclear foci
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Meiotic synapsis
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : Nucleosome assembly
Reactome : Oxidative Stress Induced Senescence
Reactome : PRC2 methylates histones and DNA
Reactome : Packaging Of Telomere Ends
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Opening
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : SIRT1 negatively regulates rRNA Expression
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : Telomere Maintenance
Reactome : Transcription
Reactome : formation of the beta-catenin:TCF transactivating complex
WikiPathway : DNA damage response
WikiPathway : Proteasome Degradation
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

SMART domain : H2A : Histone 2A
HPRD : 03465

Clone

Original Clone ID : ccsbBroad304_00717

Organism


TAX_ID : 9606
Species Specific ID: 3014

Genome

Chromosome : 11
Map Location : 11q23.3
Ensembl : ENSG00000188486

Reagents

Labome : H2AX-antibody