DNASU Plasmid Repository • 480.965.5697 | Email

ATM (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATM
Gene Name:  ataxia telangiectasia mutated
Sequence             
Original Clone ID: ccsbBroad304_10688
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00439643

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 337nts         Open reading frame : 1 to 337
Reference Sequence Alignment

ATGAGTCTAGTACTTAATGATCTGCTTATCTGCTGCCGTCAACTAGAACATGATAGAGCT
ACAGAACGAAAGAAAGAAGTTGAGAAATTTAAGCGCCTGATTCGAGATCCTGAAACAATT
AAACATCTAGATCGGCATTCAGATTCCAAACAAGGAAAATATTTGAATTGGGATGCTGTT
TTTAGATTTTTACAGAAATATATTCAGAAAGAAACAGAATGTCTGAGAATAGCAAAACCA
AATGTATCAGCCTCAACACAAGCCTCCAGGCAGAAAAAGATGCAGGAAATCAGTAGTTTG
GTCAAATACTTCATCAAATGTGCAAACAGAAGTAAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ATM
Symbol Nomenclature : ATM
SYNONYM : AT1; ATA; ATC; ATD; ATDC; ATE; TEL1; TELO1
Designation : A-T mutated|AT mutated|TEL1, telomere maintenance 1, homolog|serine-protein kinase ATM
Full Nomenclature : ataxia telangiectasia mutated
GENEID : 472
HGNC : 795
MIM : 607585
Vega : OTTHUMG00000166480
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00439643      ATGAGTCTAGTACTTAATGATCTGCTTATCTGCTGCCGTCAACTAGAACATGATAGAGCT
NM_000051.3       ATGAGTCTAGTACTTAATGATCTGCTTATCTGCTGCCGTCAACTAGAACATGATAGAGCT
                  ************************************************************

HsCD00439643      ACAGAACGAAAGAAAGAAGTTGAGAAATTTAAGCGCCTGATTCGAGATCCTGAAACAATT
NM_000051.3       ACAGAACGAAAGAAAGAAGTTGAGAAATTTAAGCGCCTGATTCGAGATCCTGAAACAATT
                  ************************************************************

HsCD00439643      AAACATCTAGATCGGCATTCAGATTCCAAACAAGGAAAATATTTGAATTGGGATGCTGTT
NM_000051.3       AAACATCTAGATCGGCATTCAGATTCCAAACAAGGAAAATATTTGAATTGGGATGCTGTT
                  ************************************************************

HsCD00439643      TTTAGATTTTTACAGAAATATATTCAGAAAGAAACAGAATGTCTGAGAATAGCAAAACCA
NM_000051.3       TTTAGATTTTTACAGAAATATATTCAGAAAGAAACAGAATGTCTGAGAATAGCAAAACCA
                  ************************************************************

HsCD00439643      AATGTATCAGCCTCAACACAAGCCTCCAGGCAGAAAAAGATGCAGGAAATCAGTAGTTTG
NM_000051.3       AATGTATCAGCCTCAACACAAGCCTCCAGGCAGAAAAAGATGCAGGAAATCAGTAGTTTG
                  ************************************************************

HsCD00439643      GTCAAATACTTCATCAAATGTGCAAACAGAAGTAAG------------------------
NM_000051.3       GTCAAATACTTCATCAAATGTGCAAACAGAAGAGCACCTAGGCTAAAATGTCAAGAACTC
                  ********************************:...                        

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTAAATTATATCATGGATACAGTGAAAGATTCATCTAATGGTGCTATTTACGGAGCTGAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TGTAGCAACATACTACTCAAAGACATTCTTTCTGTGAGAAAATACTGGTGTGAAATATCT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAGCAACAGTGGTTAGAATTGTTCTCTGTGTACTTCAGGCTCTATCTGAAACCTTCACAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GATGTTCATAGAGTTTTAGTGGCTAGAATAATTCATGCTGTTACCAAAGGATGCTGTTCT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAGACTGACGGATTAAATTCCAAATTTTTGGACTTTTTTTCCAAGGCTATTCAGTGTGCG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGACAAGAAAAGAGCTCTTCAGGTCTAAATCATATCTTAGCAGCTCTTACTATCTTCCTC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AAGACTTTGGCTGTCAACTTTCGAATTCGAGTGTGTGAATTAGGAGATGAAATTCTTCCC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ACTTTGCTTTATATTTGGACTCAACATAGGCTTAATGATTCTTTAAAAGAAGTCATTATT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GAATTATTTCAACTGCAAATTTATATCCATCATCCGAAAGGAGCCAAAACCCAAGAAAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GGTGCTTATGAATCAACAAAATGGAGAAGTATTTTATACAACTTATATGATCTGCTAGTG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AATGAGATAAGTCATATAGGAAGTAGAGGAAAGTATTCTTCAGGATTTCGTAATATTGCC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTCAAAGAAAATTTGATTGAATTGATGGCAGATATCTGTCACCAGGTTTTTAATGAAGAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ACCAGATCCTTGGAGATTTCTCAATCTTACACTACTACACAAAGAGAATCTAGTGATTAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGTGTCCCTTGCAAAAGGAAGAAAATAGAACTAGGCTGGGAAGTAATAAAAGATCACCTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAGAAGTCACAGAATGATTTTGATCTTGTGCCTTGGCTACAGATTGCAACCCAATTAATA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TCAAAGTATCCTGCAAGTTTACCTAACTGTGAGCTGTCTCCATTACTGATGATACTATCT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAGCTTCTACCCCAACAGCGACATGGGGAACGTACACCATATGTGTTACGATGCCTTACG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GAAGTTGCATTGTGTCAAGACAAGAGGTCAAACCTAGAAAGCTCACAAAAGTCAGATTTA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTAAAACTCTGGAATAAAATTTGGTGTATTACCTTTCGTGGTATAAGTTCTGAGCAAATA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAAGCTGAAAACTTTGGCTTACTTGGAGCCATAATTCAGGGTAGTTTAGTTGAGGTTGAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGAGAATTCTGGAAGTTATTTACTGGGTCAGCCTGCAGACCTTCATGTCCTGCAGTATGC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TGTTTGACTTTGGCACTGACCACCAGTATAGTTCCAGGAACGGTAAAAATGGGAATAGAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAAAATATGTGTGAAGTAAATAGAAGCTTTTCTTTAAAGGAATCAATAATGAAATGGCTC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTATTCTATCAGTTAGAGGGTGACTTAGAAAATAGCACAGAAGTGCCTCCAATTCTTCAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGTAATTTTCCTCATCTTGTACTGGAGAAAATTCTTGTGAGTCTCACTATGAAAAACTGT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AAAGCTGCAATGAATTTTTTCCAAAGCGTGCCAGAATGTGAACACCACCAAAAAGATAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GAAGAACTTTCATTCTCAGAAGTAGAAGAACTATTTCTTCAGACAACTTTTGACAAGATG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GACTTTTTAACCATTGTGAGAGAATGTGGTATAGAAAAGCACCAGTCCAGTATTGGCTTC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TCTGTCCACCAGAATCTCAAGGAATCACTGGATCGCTGTCTTCTGGGATTATCAGAACAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTTCTGAATAATTACTCATCTGAGATTACAAATTCAGAAACTCTTGTCCGGTGTTCACGT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTTTTGGTGGGTGTCCTTGGCTGCTACTGTTACATGGGTGTAATAGCTGAAGAGGAAGCA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TATAAGTCAGAATTATTCCAGAAAGCCAAGTCTCTAATGCAATGTGCAGGAGAAAGTATC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ACTCTGTTTAAAAATAAGACAAATGAGGAATTCAGAATTGGTTCCTTGAGAAATATGATG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAGCTATGTACACGTTGCTTGAGCAACTGTACCAAGAAGAGTCCAAATAAGATTGCATCT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GGCTTTTTCCTGCGATTGTTAACATCAAAGCTAATGAATGACATTGCAGATATTTGTAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGTTTAGCATCCTTCATCAAAAAGCCATTTGACCGTGGAGAAGTAGAATCAATGGAAGAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GATACTAATGGAAATCTAATGGAGGTGGAGGATCAGTCATCCATGAATCTATTTAACGAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TACCCTGATAGTAGTGTTAGTGATGCAAACGAACCTGGAGAGAGCCAAAGTACCATAGGT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GCCATTAATCCTTTAGCTGAAGAATATCTGTCAAAGCAAGATCTACTTTTCTTAGACATG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTCAAGTTCTTGTGTTTGTGTGTAACTACTGCTCAGACCAATACTGTGTCCTTTAGGGCA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GCTGATATTCGGAGGAAATTGTTAATGTTAATTGATTCTAGCACGCTAGAACCTACCAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TCCCTCCACCTGCATATGTATCTAATGCTTTTAAAGGAGCTTCCTGGAGAAGAGTACCCC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTGCCAATGGAAGATGTTCTTGAACTTCTGAAACCACTATCCAATGTGTGTTCTTTGTAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CGTCGTGACCAAGATGTTTGTAAAACTATTTTAAACCATGTCCTTCATGTAGTGAAAAAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTAGGTCAAAGCAATATGGACTCTGAGAACACAAGGGATGCTCAAGGACAGTTTCTTACA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTAATTGGAGCATTTTGGCATCTAACAAAGGAGAGGAAATATATATTCTCTGTAAGAATG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GCCCTAGTAAATTGCCTTAAAACTTTGCTTGAGGCTGATCCTTATTCAAAATGGGCCATT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTTAATGTAATGGGAAAAGACTTTCCTGTAAATGAAGTATTTACACAATTTCTTGCTGAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AATCATCACCAAGTTCGCATGTTGGCTGCAGAGTCAATCAATAGATTGTTCCAGGACACG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AAGGGAGATTCTTCCAGGTTACTGAAAGCACTTCCTTTGAAGCTTCAGCAAACAGCTTTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GAAAATGCATACTTGAAAGCTCAGGAAGGAATGAGAGAAATGTCCCATAGTGCTGAGAAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CCTGAAACTTTGGATGAAATTTATAATAGAAAATCTGTTTTACTGACGTTGATAGCTGTG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTTTTATCCTGTAGCCCTATCTGCGAAAAACAGGCTTTGTTTGCCCTGTGTAAATCTGTG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AAAGAGAATGGATTAGAACCTCACCTTGTGAAAAAGGTTTTAGAGAAAGTTTCTGAAACT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTTGGATATAGACGTTTAGAAGACTTTATGGCATCTCATTTAGATTATCTGGTTTTGGAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TGGCTAAATCTTCAAGATACTGAATACAACTTATCTTCTTTTCCTTTTATTTTATTAAAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TACACAAATATTGAGGATTTCTATAGATCTTGTTATAAGGTTTTGATTCCACATCTGGTG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATTAGAAGTCATTTTGATGAGGTGAAGTCCATTGCTAATCAGATTCAAGAGGACTGGAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGTCTTCTAACAGACTGCTTTCCAAAGATTCTTGTAAATATTCTTCCTTATTTTGCCTAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GAGGGTACCAGAGACAGTGGGATGGCACAGCAAAGAGAGACTGCTACCAAGGTCTATGAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATGCTTAAAAGTGAAAACTTATTGGGAAAACAGATTGATCACTTATTCATTAGTAATTTA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CCAGAGATTGTGGTGGAGTTATTGATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGCCT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TCTTGTATCATGGATGTGTCATTACGTAGCTTCTCCCTTTGTTGTGACTTATTAAGTCAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTTTGCCAGACAGCCGTGACTTACTGTAAGGATGCTCTAGAAAACCATCTTCATGTTATT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTTGGTACACTTATACCCCTTGTGTATGAGCAGGTGGAGGTTCAGAAACAGGTATTGGAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTGTTGAAATACTTAGTGATAGATAACAAGGATAATGAAAACCTCTATATCACGATTAAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTTTTAGATCCTTTTCCTGACCATGTTGTTTTTAAGGATTTGCGTATTACTCAGCAAAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATCAAATACAGTAGAGGACCCTTTTCACTCTTGGAGGAAATTAACCATTTTCTCTCAGTA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGTGTTTATGATGCACTTCCATTGACAAGACTTGAAGGACTAAAGGATCTTCGAAGACAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTGGAACTACATAAAGATCAGATGGTGGACATTATGAGAGCTTCTCAGGATAATCCGCAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GATGGGATTATGGTGAAACTAGTTGTCAATTTGTTGCAGTTATCCAAGATGGCAATAAAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CACACTGGTGAAAAAGAAGTTCTAGAGGCTGTTGGAAGCTGCTTGGGAGAAGTGGGTCCT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATAGATTTCTCTACCATAGCTATACAACATAGTAAAGATGCATCTTATACCAAGGCCCTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AAGTTATTTGAAGATAAAGAACTTCAGTGGACCTTCATAATGCTGACCTACCTGAATAAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ACACTGGTAGAAGATTGTGTCAAAGTTCGATCAGCAGCTGTTACCTGTTTGAAAAACATT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTAGCCACAAAGACTGGACATAGTTTCTGGGAGATTTATAAGATGACAACAGATCCAATG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTGGCCTATCTACAGCCTTTTAGAACATCAAGAAAAAAGTTTTTAGAAGTACCCAGATTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GACAAAGAAAACCCTTTTGAAGGCCTGGATGATATAAATCTGTGGATTCCTCTAAGTGAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AATCATGACATTTGGATAAAGACACTGACTTGTGCTTTTTTGGACAGTGGAGGCACAAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TGTGAAATTCTTCAATTATTAAAGCCAATGTGTGAAGTGAAAACTGACTTTTGTCAGACT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTACTTCCATACTTGATTCATGATATTTTACTCCAAGATACAAATGAATCATGGAGAAAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTGCTTTCTACACATGTTCAGGGATTTTTCACCAGCTGTCTTCGACACTTCTCGCAAACG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGCCGATCCACAACCCCTGCAAACTTGGATTCAGAGTCAGAGCACTTTTTCCGATGCTGT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTGGATAAAAAATCACAAAGAACAATGCTTGCTGTTGTGGACTACATGAGAAGACAAAAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGACCTTCTTCAGGAACAATTTTTAATGATGCTTTCTGGCTGGATTTAAATTATCTAGAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTTGCCAAGGTAGCTCAGTCTTGTGCTGCTCACTTTACAGCTTTACTCTATGCAGAAATC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TATGCAGATAAGAAAAGTATGGATGATCAAGAGAAAAGAAGTCTTGCATTTGAAGAAGGA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGCCAGAGTACAACTATTTCTAGCTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTACAGGATCTTCTCTTAGAAATCTACAGAAGTATAGGGGAGCCAGATAGTTTGTATGGC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TGTGGTGGAGGGAAGATGTTACAACCCATTACTAGACTACGAACATATGAACACGAAGCA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATGTGGGGCAAAGCCCTAGTAACATATGACCTCGAAACAGCAATCCCCTCATCAACACGC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAGGCAGGAATCATTCAGGCCTTGCAGAATTTGGGACTCTGCCATATTCTTTCCGTCTAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TTAAAAGGATTGGATTATGAAAATAAAGACTGGTGTCCTGAACTAGAAGAACTTCATTAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAAGCAGCATGGAGGAATATGCAGTGGGACCATTGCACTTCCGTCAGCAAAGAAGTAGAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GGAACCAGTTACCATGAATCATTGTACAATGCTCTACAATCTCTAAGAGACAGAGAATTC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TCTACATTTTATGAAAGTCTCAAATATGCCAGAGTAAAAGAAGTGGAAGAGATGTGTAAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CGCAGCCTTGAGTCTGTGTATTCGCTCTATCCCACACTTAGCAGGTTGCAGGCCATTGGA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GAGCTGGAAAGCATTGGGGAGCTTTTCTCAAGATCAGTCACACATAGACAACTCTCTGAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTATATATTAAGTGGCAGAAACACTCCCAGCTTCTCAAGGACAGTGATTTTAGTTTTCAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GAGCCTATCATGGCTCTACGCACAGTCATTTTGGAGATCCTGATGGAAAAGGAAATGGAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AACTCACAAAGAGAATGTATTAAGGACATTCTCACCAAACACCTTGTAGAACTCTCTATA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTGGCCAGAACTTTCAAGAACACTCAGCTCCCTGAAAGGGCAATATTTCAAATTAAACAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TACAATTCAGTTAGCTGTGGAGTCTCTGAGTGGCAGCTGGAAGAAGCACAAGTATTCTGG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GCAAAAAAGGAGCAGAGTCTTGCCCTGAGTATTCTCAAGCAAATGATCAAGAAGTTGGAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GCCAGCTGTGCAGCGAACAATCCCAGCCTAAAACTTACATACACAGAATGTCTGAGGGTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TGTGGCAACTGGTTAGCAGAAACGTGCTTAGAAAATCCTGCGGTCATCATGCAGACCTAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTAGAAAAGGCAGTAGAAGTTGCTGGAAATTATGATGGAGAAAGTAGTGATGAGCTAAGA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AATGGAAAAATGAAGGCATTTCTCTCATTAGCCCGGTTTTCAGATACTCAATACCAAAGA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATTGAAAACTACATGAAATCATCGGAATTTGAAAACAAGCAAGCTCTCCTGAAAAGAGCC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AAAGAGGAAGTAGGTCTCCTTAGGGAACATAAAATTCAGACAAACAGATACACAGTAAAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTTCAGCGAGAGCTGGAGTTGGATGAATTAGCCCTGCGTGCACTGAAAGAGGATCGTAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CGCTTCTTATGTAAAGCAGTTGAAAATTATATCAACTGCTTATTAAGTGGAGAAGAACAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GATATGTGGGTATTCCGACTTTGTTCCCTCTGGCTTGAAAATTCTGGAGTTTCTGAAGTC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AATGGCATGATGAAGAGAGACGGAATGAAGATTCCAACATATAAATTTTTGCCTCTTATG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TACCAATTGGCTGCTAGAATGGGGACCAAGATGATGGGAGGCCTAGGATTTCATGAAGTC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTCAATAATCTAATCTCTAGAATTTCAATGGATCACCCCCATCACACTTTGTTTATTATA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CTGGCCTTAGCAAATGCAAACAGAGATGAATTTCTGACTAAACCAGAGGTAGCCAGAAGA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGCAGAATAACTAAAAATGTGCCTAAACAAAGCTCTCAGCTTGATGAGGATCGAACAGAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GCTGCAAATAGAATAATATGTACTATCAGAAGTAGGAGACCTCAGATGGTCAGAAGTGTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GAGGCACTTTGTGATGCTTATATTATATTAGCAAACTTAGATGCCACTCAGTGGAAGACT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAGAGAAAAGGCATAAATATTCCAGCAGACCAGCCAATTACTAAACTTAAGAATTTAGAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GATGTTGTTGTCCCTACTATGGAAATTAAGGTGGACCACACAGGAGAATATGGAAATCTG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTGACTATACAGTCATTTAAAGCAGAATTTCGCTTAGCAGGAGGTGTAAATTTACCAAAA
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATAATAGATTGTGTAGGTTCCGATGGCAAGGAGAGGAGACAGCTTGTTAAGGGCCGTGAT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GACCTGAGACAAGATGCTGTCATGCAACAGGTCTTCCAGATGTGTAATACATTACTGCAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGAAACACGGAAACTAGGAAGAGGAAATTAACTATCTGTACTTATAAGGTGGTTCCCCTC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TCTCAGCGAAGTGGTGTTCTTGAATGGTGCACAGGAACTGTCCCCATTGGTGAATTTCTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GTTAACAATGAAGATGGTGCTCATAAAAGATACAGGCCAAATGATTTCAGTGCCTTTCAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TGCCAAAAGAAAATGATGGAGGTGCAAAAAAAGTCTTTTGAAGAGAAATATGAAGTCTTC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATGGATGTTTGCCAAAATTTTCAACCAGTTTTCCGTTACTTCTGCATGGAAAAATTCTTG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GATCCAGCTATTTGGTTTGAGAAGCGATTGGCTTATACGCGCAGTGTAGCTACTTCTTCT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ATTGTTGGTTACATACTTGGACTTGGTGATAGACATGTACAGAATATCTTGATAAATGAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CAGTCAGCAGAACTTGTACATATAGATCTAGGTGTTGCTTTTGAACAGGGCAAAATCCTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CCTACTCCTGAGACAGTTCCTTTTAGACTCACCAGAGATATTGTGGATGGCATGGGCATT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ACGGGTGTTGAAGGTGTCTTCAGAAGATGCTGTGAGAAAACCATGGAAGTGATGAGAAAC
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       TCTCAGGAAACTCTGTTAACCATTGTAGAGGTCCTTCTATATGATCCACTCTTTGACTGG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       ACCATGAATCCTTTGAAAGCTTTGTATTTACAGCAGAGGCCGGAAGATGAAACTGAGCTT
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       CACCCTACTCTGAATGCAGATGACCAAGAATGCAAACGAAATCTCAGTGATATTGACCAG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       AGTTTCAACAAAGTAGCTGAACGTGTCTTAATGAGACTACAAGAGAAACTGAAAGGAGTG
                                                                              

HsCD00439643      ------------------------------------------------------------
NM_000051.3       GAAGAAGGCACTGTGCTCAGTGTTGGTGGACAAGTGAATTTGCTCATACAGCAGGCCATA
                                                                              

HsCD00439643      ---------------------------------------------------
NM_000051.3       GACCCCAAAAATCTCAGCCGACTTTTCCCAGGATGGAAAGCTTGGGTGTGA
                                                                     

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Canonical NF-kappaB pathway
NCI : E2F transcription factor network
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
NCI : p38 MAPK signaling pathway
NCI : p53 pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Fanconi Anemia pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of the Fanconi anemia pathway
Reactome : Stabilization of p53
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : G1 to S cell cycle control
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : TP53 network
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

HPRD : 06347

Clone

Original Clone ID : ccsbBroad304_10688

Organism


TAX_ID : 9606
Species Specific ID: 472

Genome

Chromosome : 11
Map Location : 11q22-q23
Ensembl : ENSG00000149311

Reagents

Labome : ATM-antibody