DNASU Plasmid Repository • 480.965.5697 | Email

IL8 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IL8
Gene Name:  interleukin 8
Sequence             
Original Clone ID: ccsbBroad304_00854
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00439996

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 298nts         Open reading frame : 1 to 298
Reference Sequence Alignment

ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCA


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IL8
Symbol Nomenclature : IL8
SYNONYM : CXCL8; GCP-1; GCP1; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP-1; NAP1
Designation : T-cell chemotactic factor|alveolar macrophage chemotactic factor I|beta endothelial cell-derived neutrophil activating peptide|beta-thromboglobulin-like protein|chemokine (C-X-C motif) ligand 8|emoctakin|granulocyte chemotactic protein 1|interleukin-8|lung giant cell carcinoma-derived chemotactic protein|lymphocyte derived neutrophil activating peptide|monocyte-derived neutrophil chemotactic factor|monocyte-derived neutrophil-activating peptide|neutrophil-activating peptide 1|small inducible cytokine subfamily B, member 8|tumor necrosis factor-induced gene 1
Full Nomenclature : interleukin 8
GENEID : 3576
GenBank Accession : DQ893727
HGNC : 6025
MIM : 146930
Vega : OTTHUMG00000151316
Target GenBank: DQ893727

 

Reference Sequence Alignment

  

HsCD00439996      ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
NM_000584.3       ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
                  ************************************************************

HsCD00439996      GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
NM_000584.3       GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
                  ************************************************************

HsCD00439996      TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
NM_000584.3       TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
                  ************************************************************

HsCD00439996      TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
NM_000584.3       TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
                  ************************************************************

HsCD00439996      AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCA---
NM_000584.3       AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA
                  *********************************************************   

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Glucocorticoid receptor regulatory network
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : IL8-mediated signaling events
NCI : LPA receptor mediated events
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-3-mediated signaling events
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Interleukin signaling pathway
WikiPathway : EBV LMP1 signaling
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : Senescence and Autophagy
WikiPathway : Toll-like receptor signaling pathway

Clone

Original Clone ID : ccsbBroad304_00854

Organism


TAX_ID : 9606
Species Specific ID: 3576

Genome

Chromosome : 4
Map Location : 4q13-q21
Ensembl : ENSG00000169429

Reagents

Labome : IL-8-antibody