DNASU Plasmid Repository • 480.965.5697 | Email

MRE11A (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MRE11A
Gene Name:  MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Sequence             
Original Clone ID: ccsbBroad304_13901
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00441958

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 619nts         Open reading frame : 1 to 619
Reference Sequence Alignment

ATGAGTACTGCATATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGAT
ATTCATCTTGGATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTC
GATGAAATTTTAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGAT
CTTTTTCATGAAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGA
AAATATTGTATGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAAC
TTTGGTTTTAGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATT
CCAGTGTTTAGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCC
TTGGACATTTTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAG
AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
TTGAGACCAAAGAAAGAT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
2 errors; 2 non-synonomous errors
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MRE11A
Symbol Nomenclature : MRE11A
SYNONYM : ATLD; HNGS1; MRE11; MRE11B
Designation : AT-like disease|DNA recombination and repair protein|MRE11 homolog 1|MRE11 homolog A|double-strand break repair protein MRE11A|endo/exonuclease Mre11|meiotic recombination 11 homolog 1|meiotic recombination 11 homolog A
Full Nomenclature : MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
GENEID : 4361
HGNC : 7230
MIM : 600814
Vega : OTTHUMG00000167780
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ATGAGTACTGCAGATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGAT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ATTCATCTTGGATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         GATGAAATTTTAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGAT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         CTTTTTCATGAAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         AAATATTGTATGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAAC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         TTTGGTTTTAGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         CCAGTGTTTAGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------ATGTCTGTGGAG
NM_005591.3         TTGGACATTTTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
NM_005591.3         AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
NM_005591.3         TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
NM_005591.3         TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
NM_005591.3         AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
NM_005591.3         GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
NM_005591.3         TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
NM_005591.3         AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ---------------------------------ATGAGTACTGCATATGCACTTGATGAT
XM_005274008.1      CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
NM_005591.3         CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
NM_005590.3         ---------------------------------ATGAGTACTGCAGATGCACTTGATGAT
XM_005274007.1      ---------------------------------ATGAGTACTGCAGATGCACTTGATGAT
                                                     ** . *. :**: ** .:* :** .:*

HsCD00441958        GAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAAGAT
XM_005274008.1      TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
NM_005591.3         TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
NM_005590.3         GAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAAGAT
XM_005274007.1      GAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAAGAT
                     ::***.** :***:. :::***:.*...**. **:**:.    .* *:*******..:*

HsCD00441958        GCAGTCAG----------------------------------------------------
XM_005274008.1      GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
NM_005591.3         GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
NM_005590.3         GCAGTCAG----------------------------------------------------
XM_005274007.1      GCAGTCAG----------------------------------------------------
                    *.**:.*                                                     

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
NM_005591.3         CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
NM_005591.3         TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      CATAGAGAACAAAAGGAAAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAG
NM_005591.3         CATAGAGAACAAAAGGAAAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      CCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCA
NM_005591.3         CCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      GAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAA
NM_005591.3         GAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00441958        -----AGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAGGAAAAT
XM_005274008.1      TTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAA
NM_005591.3         TTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAA
NM_005590.3         -----AGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAGGAAAAT
XM_005274007.1      -----AGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAGGAAAAT
                         .*..** ** ..*:::*::.*..* ** ***:*: *.*.* :  .  :******:

HsCD00441958        GAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCAAGGAAA
XM_005274008.1      ACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAG
NM_005591.3         ACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAG
NM_005590.3         GAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCAAGGAAA
XM_005274007.1      GAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCAAGGAAA
                    ..* :* .:***.**::. :* ** .*.:* :*   *: ***.* **.. * .:..*.*.

HsCD00441958        ACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCTGTCCAG
XM_005274008.1      GTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGT
NM_005591.3         GTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGT
NM_005590.3         ACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCTGTCCAG
XM_005274007.1      ACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCTGTCCAG
                    . *  :*.*: *:*. :... : * :**.***::.*:.*.:.*.:*** .  .:****. 

HsCD00441958        TTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTAGTAAGTTTCCATGGGTGAAC
XM_005274008.1      GAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTT
NM_005591.3         GAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTT
NM_005590.3         TTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTAGTAAGTTTCCATGGGTGAAC
XM_005274007.1      TTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTAGTAAGTTTCCATGGGTGAAC
                     : *.:** . *** *. ... ** ***..* * . * :.. .*** * *:*  *  :: 

HsCD00441958        TATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTAGTATTCATGGCAATCATGAC
XM_005274008.1      AGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGAT
NM_005591.3         AGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGAT
NM_005590.3         TATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTAGTATTCATGGCAATCATGAC
XM_005274007.1      TATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTAGTATTCATGGCAATCATGAC
                    :.* .:****.*.: .* *. **: .::*: ***:. : *  . *.***.*:.* **** 

HsCD00441958        G-------------ATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTTTAAGTTG
XM_005274008.1      AGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGA
NM_005591.3         AGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGA
NM_005590.3         G-------------ATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTTTAAGTTG
XM_005274007.1      G-------------ATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTTTAAGTTG
                    .             *:**.***..**.*** **. :  .:*.  * **..:  *...: .

HsCD00441958        TGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACATTAGTCC
XM_005274008.1      GGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAG
NM_005591.3         GGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAG
NM_005590.3         TGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACATTAGTCC
XM_005274007.1      TGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACATTAGTCC
                     *  .**:** :..***.. : *.. **  .*:. . *:.***.*** * : .* :* . 

HsCD00441958        GGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAGGATCCATTCCAGA
XM_005274008.1      ACTTCTACCCGTAGCAGGAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTATT
NM_005591.3         ACTTCTACCCGTAGCAGGAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTATT
NM_005590.3         GGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAGGATCCATTCCAGA
XM_005274007.1      GGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAGGATCCATTCCAGA
                    . ** *.*   :*..*****  ..**...*   *  : *  .* ***.*: .: ** * :

HsCD00441958        TGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATGTTGAGACCAAAGAAAGA
XM_005274008.1      ATAGATGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTAT
NM_005591.3         ATAGATGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTAT
NM_005590.3         TGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATGTTGAGACCAAAGGAAGA
XM_005274007.1      TGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATGTTGAGACCAAAGGAAGA
                    : *.* **  *::..:.*. ::*:**. *...::  ...***** .. ** **...::.:

HsCD00441958        T-----------------------------------------------------------
XM_005274008.1      TCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCA
NM_005591.3         TCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCA
NM_005590.3         TGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGGAGTAAACATGGAAGTAC
XM_005274007.1      TGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGGAGTAAACATGGAAGTAC
                    *                                                           

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      AAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTA
NM_005591.3         AAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTA
NM_005590.3         TAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTTGTTATCTGGGGCCATGA
XM_005274007.1      TAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTTGTTATCTGGGGCCATGA
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      TCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACT
NM_005591.3         TCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACT
NM_005590.3         ACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTGTTTTATATCTCACAACC
XM_005274007.1      ACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTGTTTTATATCTCACAACC
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      AGTTCTTTAAGAAGAAATAGAAGATAA---------------------------------
NM_005591.3         AGTTCTTTAAGAAGAAATAGAAGATAA---------------------------------
NM_005590.3         TGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTAAAGAAACATGTTGGTTT
XM_005274007.1      TGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTAAAGAAACATGTTGGTTT
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCTCTTCACACAGTGCGGCA
XM_005274007.1      GCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCTCTTCACACAGTGCGGCA
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATTTTTAACCCAGATAATCC
XM_005274007.1      GTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATTTTTAACCCAGATAATCC
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATTGAAGAAATGCTTGAAAA
XM_005274007.1      TAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATTGAAGAAATGCTTGAAAA
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAGCCTCTTGTACGACTGCG
XM_005274007.1      TGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAGCCTCTTGTACGACTGCG
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGCTTTAGCCAGAAATTTGT
XM_005274007.1      AGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGCTTTAGCCAGAAATTTGT
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGGCATAGAGAACAAAAGGA
XM_005274007.1      GGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGGCATAGAGAACAAAAGGA
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAGCCTTCAGAAGGAACAAC
XM_005274007.1      AAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAGCCTTCAGAAGGAACAAC
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCAGAGAAGAATGTGCAGCT
XM_005274007.1      TTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCAGAGAAGAATGTGCAGCT
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAATTTGTGGACAAGGAGGA
XM_005274007.1      CTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAATTTGTGGACAAGGAGGA
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAAACACAGCGATTTCTTAA
XM_005274007.1      GAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAAACACAGCGATTTCTTAA
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAGGTACGTCGTTTCAGAGA
XM_005274007.1      AGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAGGTACGTCGTTTCAGAGA
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGTGAGGCTATGACCAGGGC
XM_005274007.1      AACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGTGAGGCTATGACCAGGGC
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTTAGTGCTGATGACCTTAT
XM_005274007.1      CAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTTAGTGCTGATGACCTTAT
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGATAGCATCTCAGCAGCAAC
XM_005274007.1      GAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGATAGCATCTCAGCAGCAAC
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGAGGGCAGAATTCAGCATC
XM_005274007.1      CAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGAGGGCAGAATTCAGCATC
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GAGAGGAGGGTCTCAAAGAGGAAGAGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAA
XM_005274007.1      GAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAGACTTCTACCCGTAGCAG
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TGTCACTACTAAGAATTATTCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGA
XM_005274007.1      GAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTATTATAGATGCCTTTAAATC
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CATTTTTCCTACCACTTCAAAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAAT
XM_005274007.1      TACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTATTCAGAGGTGATTGAGGT
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CATGTCCCAGAGTCAAGTATCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGA
XM_005274007.1      AGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCAAAGACAGATCAAAGGTG
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TGATCCTTTTATGAACACTAGTTCTTTAAGAAGAAATAGAAGATAA--------------
XM_005274007.1      GTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTATCGAAAGGGGTTGATTT
                                                                                

HsCD00441958        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      TGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACTAGTTCTTTAAGAAGAAA
                                                                                

HsCD00441958        ----------
XM_005274008.1      ----------
NM_005591.3         ----------
NM_005590.3         ----------
XM_005274007.1      TAGAAGATAA
                              

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
Reactome : Assembly of the RAD50-MRE11-NBS1 complex at DNA double-strand breaks
Reactome : Cell Cycle
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MRN complex relocalizes to nuclear foci
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : STING mediated induction of host immune responses
WikiPathway : DNA damage response
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Non-homologous end joining
WikiPathway : miRNA regulation of DNA Damage Response

Protein

HPRD : 02889

Clone

Original Clone ID : ccsbBroad304_13901

Organism


TAX_ID : 9606
Species Specific ID: 4361

Genome

Chromosome : 11
Map Location : 11q21
Ensembl : ENSG00000020922

Reagents

Labome : Mre11-antibody