DNASU Plasmid Repository • 480.965.5697 | Email

UBE2D1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  UBE2D1
Gene Name:  ubiquitin-conjugating enzyme E2D 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH025199.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00004420

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 444nts         Open reading frame : 1 to 444
Reference Sequence Alignment

ATGGCGCTGAAGAGGATTCAGAAAGAATTGAGTGATCTACAGCGCGATCCACCTGCTCAC
TGTTCAGCTGGACCTGTGGGAGATGACTTGTTCCACTGGCAAGCCACTATTATGGGGCCT
CCTGATAGCGCATATCAAGGTGGAGTCTTCTTTCTCACTGTACATTTTCCGACAGATTAT
CCTTTTAAACCACCAAAGATTGCTTTCACAACAAAAATTTACCATCCAAACATAAACAGT
AATGGAAGTATTTGTCTCGATATTCTGAGGTCACAATGGTCACCAGCTCTGACTGTATCA
AAAGTTTTATTGTCCATATGTTCTCTACTTTGTGATCCTAATCCAGATGACCCCTTAGTA
CCAGATATTGCACAAATCTATAAATCAGACAAAGAAAAATACAACAGACATGCAAGAGAA
TGGACTCAGAAATATGCAATGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 638
Start on reference sequence 195
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : UBE2D1
Symbol Nomenclature : UBE2D1
SYNONYM : E2(17)KB1; SFT; UBC4/5; UBCH5; UBCH5A
Designation : UBC4/5 homolog|stimulator of Fe transport|ubiquitin carrier protein D1|ubiquitin-conjugating enzyme E2 D1|ubiquitin-conjugating enzyme E2(17)KB 1|ubiquitin-conjugating enzyme E2-17 kDa 1|ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)|ubiquitin-protein ligase D1
Full Nomenclature : ubiquitin-conjugating enzyme E2D 1
GENEID : 7321
GI : 61361662
GenBank Accession : AY890141
HGNC : 12474
MIM : 602961
Vega : OTTHUMG00000018269
Target GenBank: BC005980

 

Reference Sequence Alignment

  

HsCD00004420      ATGGCGCTGAAGAGGATTCAGAAAGAATTGAGTGATCTACAGCGCGATCCACCTGCTCAC
NM_003338.4       ATGGCGCTGAAGAGGATTCAGAAAGAATTGAGTGATCTACAGCGCGATCCACCTGCTCAC
NM_015983.3       ATGGCGCTAAAGCGGATCCAGAAGGAATTAACCGACTTGCAGAGGGATCCTCCTGCCCAG
                  ********.***.**** *****.*****.*  **  *.***.* *****:***** ** 

HsCD00004420      TGTTCAGCTGGACCTGTGGGAGATGACTTGTTCCACTGGCAAGCCACTATTATGGGGCCT
NM_003338.4       TGTTCAGCTGGACCTGTGGGAGATGACTTGTTCCACTGGCAAGCCACTATTATGGGGCCT
NM_015983.3       TGTTCTGCAGGACCTGTCGGTGATGACTTGTTCCACTGGCAGGCCACCATCATGGGCCCG
                  *****:**:******** **:********************.***** ** ***** ** 

HsCD00004420      CCTGATAGCGCATATCAAGGTGGAGTCTTCTTTCTCACTGTACATTTTCCGACAGATTAT
NM_003338.4       CCTGATAGCGCATATCAAGGTGGAGTCTTCTTTCTCACTGTACATTTTCCGACAGATTAT
NM_015983.3       AATGACAGTCCTTACCAAGGAGGTGTTTTCTTCCTGACCATCCACTTTCCTACAGATTAC
                  ..*** **  *:** *****:**:** ***** ** ** .*.** ***** ******** 

HsCD00004420      CCTTTTAAACCACCAAAGATTGCTTTCACAACAAAAATTTACCATCCAAACATAAACAGT
NM_003338.4       CCTTTTAAACCACCAAAGATTGCTTTCACAACAAAAATTTACCATCCAAACATAAACAGT
NM_015983.3       CCGTTCAAGCCCCCAAAGGTTGCTTTCACAACCAAAATTTATCACCCTAATATCAACAGC
                  ** ** **.**.******.*************.******** ** **:** **.***** 

HsCD00004420      AATGGAAGTATTTGTCTCGATATTCTGAGGTCACAATGGTCACCAGCTCTGACTGTATCA
NM_003338.4       AATGGAAGTATTTGTCTCGATATTCTGAGGTCACAATGGTCACCAGCTCTGACTGTATCA
NM_015983.3       AATGGCAGCATCTGCCTTGATATCCTGCGGTCTCAGTGGTCTCCAGCGTTGACTGTGTCA
                  *****.** ** ** ** ***** ***.****:**.*****:*****  *******.***

HsCD00004420      AAAGTTTTATTGTCCATATGTTCTCTACTTTGTGATCCTAATCCAGATGACCCCTTAGTA
NM_003338.4       AAAGTTTTATTGTCCATATGTTCTCTACTTTGTGATCCTAATCCAGATGACCCCTTAGTA
NM_015983.3       AAAGTTCTCTTGTCCATCTGCTCGCTGCTCTGCGACCCCAACCCCGATGACCCCCTGGTG
                  ****** *.********.** ** **.** ** ** ** ** **.********* *.**.

HsCD00004420      CCAGATATTGCACAAATCTATAAATCAGACAAAGAAAAATACAACAGACATGCAAGAGAA
NM_003338.4       CCAGATATTGCACAAATCTATAAATCAGACAAAGAAAAATACAACAGACATGCAAGAGAA
NM_015983.3       CCAGAGATAGCACACACCTACAAGGCCGACAGAGAGAAGTACAACAGACTAGCAAGAGAG
                  ***** **:*****.* *** **. *.****.***.**.**********::********.

HsCD00004420      TGGACTCAGAAATATGCAATGTAG
NM_003338.4       TGGACTCAGAAATATGCAATGTAA
NM_015983.3       TGGACACAAAAATATGCTATGTAA
                  *****:**.********:*****.

Pathways

NCI : Internalization of ErbB1
NCI : p53 pathway
Panther : Ubiquitin proteasome pathway
Reactome : APC-Cdc20 mediated degradation of Nek2A
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Cyclin B
Reactome : APC/C:Cdc20 mediated degradation of Securin
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : Activated TLR4 signalling
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Autodegradation of Cdh1 by Cdh1:APC/C
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Conversion from APC/C:Cdc20 to APC/C:Cdh1 in late anaphase
Reactome : Disease
Reactome : Downregulation of SMAD2/3:SMAD4 transcriptional activity
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : IKK complex recruitment mediated by RIP1
Reactome : Immune System
Reactome : Inactivation of APC/C via direct inhibition of the APC/C complex
Reactome : Inhibition of the proteolytic activity of APC/C required for the onset of anaphase by mitotic spindle checkpoint components
Reactome : Innate Immune System
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Spindle Checkpoint
Reactome : MyD88-independent cascade
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Phosphorylation of the APC/C
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Regulation of mitotic cell cycle
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by BMP
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
WikiPathway : Proteasome Degradation

Clone

Cloning Information : 25199
HIP Master Clone ID : 55575
Original Clone ID : FLH025199.01X

Organism


TAX_ID : 9606
Species Specific ID: 7321

Genome

Chromosome : 10
Map Location : 10q21.1
Ensembl : ENSG00000072401

Reagents

Labome : UBE2D1-antibody