DNASU Plasmid Repository • 480.965.5697 | Email

EIF2S1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EIF2S1
Gene Name:  eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH183492.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00044214

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 948nts         Open reading frame : 1 to 948
Reference Sequence Alignment

ATGCCGGGTCTAAGTTGTAGATTTTATCAACACAAATTTCCTGAGGTGGAAGATGTAGTG
ATGGTGAATGTCAGATCCATTGCTGAAATGGGGGCTTATGTCAGCTTGCTGGAATACAAC
AACATTGAAGGCATGATTCTTCTTAGTGAATTATCCAGAAGGCGTATCCGTTCTATCAAC
AAACTCATCCGAATTGGCAGGAATGAGTGTGTGGTTGTCATTAGGGTGGACAAAGAAAAA
GGATATATTGATTTGTCAAAAAGAAGAGTTTCTCCAGAGGAAGCAATCAAATGTGAAGAC
AAATTCACAAAATCCAAAACTGTTTATAGCATTCTTCGTCATGTTGCTGAGGTGTTAGAA
TACACCAAGGATGAGCAGCTGGAAAGCCTATTCCAGAGGACTGCCTGGGTCTTTGATGAC
AAGTACAAGAGACCTGGATATGGTGCCTATGATGCATTTAAGCATGCAGTCTCAGACCCA
TCTATTTTGGATAGTTTAGATTTGAATGAAGATGAACGGGAAGTACTCATTAATAATATT
AATAGGCGCTTGACCCCACAGGCTGTCAAAATTCGAGCAGATATTGAAGTGGCTTGTTAT
GGTTATGAAGGCATTGATGCTGTAAAAGAAGCCCTAAGAGCAGGTTTGAATTGTTCTACA
GAAAACATGCCCATTAAGATTAATCTAATAGCTCCTCCTCGGTATGTAATGACTACGACA
ACCCTGGAGAGAACAGAAGGCCTTTCTGTCCTCAGTCAAGCTATGGCTGTTATCAAAGAG
AAGATTGAGGAAAAGAGGGGTGTGTTCAATGTTCAAATGGAGCCCAAAGTGGTCACAGAT
ACAGATGAGACTGAACTTGCGAGGCAGATGGAGAGGCTTGAAAGAGAAAATGCCGAAGTG
GATGGAGATGATGATGCAGAAGAAATGGAAGCCAAAGCTGAAGATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1047
Start on reference sequence 100
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EIF2S1
Symbol Nomenclature : EIF2S1
SYNONYM : EIF-2; EIF-2A; EIF-2alpha; EIF2; EIF2A
Designation : eIF-2-alpha|eukaryotic translation initiation factor 2 subunit 1|eukaryotic translation initiation factor 2 subunit alpha
Full Nomenclature : eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
GENEID : 1965
HGNC : 3265
MIM : 603907
Vega : OTTHUMG00000029800
Target GenBank: BC002513

 

Reference Sequence Alignment

  

HsCD00044214      ATGCCGGGTCTAAGTTGTAGATTTTATCAACACAAATTTCCTGAGGTGGAAGATGTAGTG
NM_004094.4       ATGCCGGGTCTAAGTTGTAGATTTTATCAACACAAATTTCCTGAGGTGGAAGATGTAGTG
                  ************************************************************

HsCD00044214      ATGGTGAATGTCAGATCCATTGCTGAAATGGGGGCTTATGTCAGCTTGCTGGAATACAAC
NM_004094.4       ATGGTGAATGTCAGATCCATTGCTGAAATGGGGGCTTATGTCAGCTTGCTGGAATACAAC
                  ************************************************************

HsCD00044214      AACATTGAAGGCATGATTCTTCTTAGTGAATTATCCAGAAGGCGTATCCGTTCTATCAAC
NM_004094.4       AACATTGAAGGCATGATTCTTCTTAGTGAATTATCCAGAAGGCGTATCCGTTCTATCAAC
                  ************************************************************

HsCD00044214      AAACTCATCCGAATTGGCAGGAATGAGTGTGTGGTTGTCATTAGGGTGGACAAAGAAAAA
NM_004094.4       AAACTCATCCGAATTGGCAGGAATGAGTGTGTGGTTGTCATTAGGGTGGACAAAGAAAAA
                  ************************************************************

HsCD00044214      GGATATATTGATTTGTCAAAAAGAAGAGTTTCTCCAGAGGAAGCAATCAAATGTGAAGAC
NM_004094.4       GGATATATTGATTTGTCAAAAAGAAGAGTTTCTCCAGAGGAAGCAATCAAATGTGAAGAC
                  ************************************************************

HsCD00044214      AAATTCACAAAATCCAAAACTGTTTATAGCATTCTTCGTCATGTTGCTGAGGTGTTAGAA
NM_004094.4       AAATTCACAAAATCCAAAACTGTTTATAGCATTCTTCGTCATGTTGCTGAGGTGTTAGAA
                  ************************************************************

HsCD00044214      TACACCAAGGATGAGCAGCTGGAAAGCCTATTCCAGAGGACTGCCTGGGTCTTTGATGAC
NM_004094.4       TACACCAAGGATGAGCAGCTGGAAAGCCTATTCCAGAGGACTGCCTGGGTCTTTGATGAC
                  ************************************************************

HsCD00044214      AAGTACAAGAGACCTGGATATGGTGCCTATGATGCATTTAAGCATGCAGTCTCAGACCCA
NM_004094.4       AAGTACAAGAGACCTGGATATGGTGCCTATGATGCATTTAAGCATGCAGTCTCAGACCCA
                  ************************************************************

HsCD00044214      TCTATTTTGGATAGTTTAGATTTGAATGAAGATGAACGGGAAGTACTCATTAATAATATT
NM_004094.4       TCTATTTTGGATAGTTTAGATTTGAATGAAGATGAACGGGAAGTACTCATTAATAATATT
                  ************************************************************

HsCD00044214      AATAGGCGCTTGACCCCACAGGCTGTCAAAATTCGAGCAGATATTGAAGTGGCTTGTTAT
NM_004094.4       AATAGGCGCTTGACCCCACAGGCTGTCAAAATTCGAGCAGATATTGAAGTGGCTTGTTAT
                  ************************************************************

HsCD00044214      GGTTATGAAGGCATTGATGCTGTAAAAGAAGCCCTAAGAGCAGGTTTGAATTGTTCTACA
NM_004094.4       GGTTATGAAGGCATTGATGCTGTAAAAGAAGCCCTAAGAGCAGGTTTGAATTGTTCTACA
                  ************************************************************

HsCD00044214      GAAAACATGCCCATTAAGATTAATCTAATAGCTCCTCCTCGGTATGTAATGACTACGACA
NM_004094.4       GAAAACATGCCCATTAAGATTAATCTAATAGCTCCTCCTCGGTATGTAATGACTACGACA
                  ************************************************************

HsCD00044214      ACCCTGGAGAGAACAGAAGGCCTTTCTGTCCTCAGTCAAGCTATGGCTGTTATCAAAGAG
NM_004094.4       ACCCTGGAGAGAACAGAAGGCCTTTCTGTCCTCAGTCAAGCTATGGCTGTTATCAAAGAG
                  ************************************************************

HsCD00044214      AAGATTGAGGAAAAGAGGGGTGTGTTCAATGTTCAAATGGAGCCCAAAGTGGTCACAGAT
NM_004094.4       AAGATTGAGGAAAAGAGGGGTGTGTTCAATGTTCAAATGGAGCCCAAAGTGGTCACAGAT
                  ************************************************************

HsCD00044214      ACAGATGAGACTGAACTTGCGAGGCAGATGGAGAGGCTTGAAAGAGAAAATGCCGAAGTG
NM_004094.4       ACAGATGAGACTGAACTTGCGAGGCAGATGGAGAGGCTTGAAAGAGAAAATGCCGAAGTG
                  ************************************************************

HsCD00044214      GATGGAGATGATGATGCAGAAGAAATGGAAGCCAAAGCTGAAGATTAG
NM_004094.4       GATGGAGATGATGATGCAGAAGAAATGGAAGCCAAAGCTGAAGATTAA
                  ***********************************************.

Pathways

NCI : Validated targets of C-MYC transcriptional activation
Panther : Apoptosis signaling pathway
Reactome : 3' -UTR-mediated translational regulation
Reactome : Activation of the mRNA upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S
Reactome : Cap-dependent Translation Initiation
Reactome : Eukaryotic Translation Initiation
Reactome : Formation of the ternary complex, and subsequently, the 43S complex
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Metabolism of proteins
Reactome : PERK regulates gene expression
Reactome : Recycling of eIF2:GDP
Reactome : Ribosomal scanning and start codon recognition
Reactome : Translation
Reactome : Translation initiation complex formation
Reactome : Unfolded Protein Response (UPR)
WikiPathway : Translation Factors

Protein

SMART domain : S1 : Ribosomal protein S1-like RNA-binding domain
UniProt : Q53XC0
UniProt : P05198
HPRD : 04881

Clone

Cloning Information : 183492
HIP Master Clone ID : 158436
Original Clone ID : FLH183492.01X

Organism


TAX_ID : 9606
Species Specific ID: 1965

Genome

Chromosome : 14
Map Location : 14q23.3
Ensembl : ENSG00000134001

Reagents

Labome : eIF2alpha-antibody