DNASU Plasmid Repository • 480.965.5697 | Email

SLCO1B1 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SLCO1B1
Gene Name:  solute carrier organic anion transporter family, member 1B1
Sequence             
Original Clone ID: ccsbBroad304_07645
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00443578

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2074nts         Open reading frame : 1 to 2074
Reference Sequence Alignment

ATGGACCAAAATCAACATTTGAATAAAACAGCAGAGGCACAACCTTCAGAGAATAAGAAA
ACAAGATACTGCAATGGATTGAAGATGTTCTTGGCAGCTCTGTCACTCAGCTTTATTGCT
AAGACACTAGGTGCAATTATTATGAAAAGTTCCATCATTCATATAGAACGGAGATTTGAG
ATATCCTCTTCTCTTGTTGGTTTTATTGACGGAAGCTTTGAAATTGGAAATTTGCTTGTG
ATTGTATTTGTGAGTTACTTTGGATCCAAACTACATAGACCAAAGTTAATTGGAATCGGT
TGTTTCATTATGGGAATTGGAGGTGTTTTGACTGCTTTGCCACATTTCTTCATGGGATAT
TACAGGTATTCTAAAGAAACTAATATCGATTCATCAGAAAATTCAACATCAACCTTATCC
ACTTGTTTAATTAATCAAATTTTATCACTCAATAGAGCATCAACTGAGATAGTGGGAAAA
GGTTGTTTAAAGGAATCTGGGTCATACATGTGGATATATGTGTTCATGGGTAATATGCTT
CGTGGAATAGGGGAGACTCCCATAGTACCACTGGGGCTTTCTTACATTGATGATTTTGCT
AAAGAAGGACATTCTTCTTTGTATTTAGGTATATTGAATGCAATAGCAATGATTGGTCCA
ATCATTGGCTTTACCCTGGGATCTCTGTTTTCTAAAATGTACGTGGATATTGGATATGTA
GATCTAAGCACTATCAGGATAACTCCTACTGATTCTCGATGGGTTGGAGCTTGGTGGCTT
AATTTCCTTGTGTCTGGACTATTCTCCATTATTTCTTCCATACCATTCTTTTTCTTGCCC
CAAACTCCAAATAAACCACAAAAAGAAAGAAAAGCTTCACTGTCTTTGCATGTGCTGGAA
ACAAATGATGAAAAGGATCAAACAGCTAATTTGACCAATCAAGGAAAAAATATTACCAAA
AATGTGACTGGTTTTTTCCAGTCTTTTAAAAGCATCCTTACTAATCCCCTGTATGTTATG
TTTGTGCTTTTGACGTTGTTACAAGTAAGCAGCTATATTGGTGCTTTTACTTATGTCTTC
AAATACGTAGAGCAACAGTATGGTCAGCCTTCATCTAAGGCTAACATCTTATTGGGAGTC
ATAACCATACCTATTTTTGCAAGTGGAATGTTTTTAGGAGGATATATCATTAAAAAATTC
AAACTGAACACCGTTGGAATTGCCAAATTCTCATGTTTTACTGCTGTGATGTCATTGTCC
TTTTACCTATTATATTTTTTCATACTCTGTGAAAACAAATCAGTTGCCGGACTAACCATG
ACCTATGATGGAAATAATCCAGTGACATCTCATAGAGATGTACCACTTTCTTATTGCAAC
TCAGACTGCAATTGTGATGAAAGTCAATGGGAACCAGTCTGTGGAAACAATGGAATAACT
TACATCTCACCCTGTCTAGCAGGTTGCAAATCTTCAAGTGGCAATAAAAAGCCTATAGTG
TTTTACAACTGCAGTTGTTTGGAAGTAACTGGTCTCCAGAACAGAAATTACTCAGCCCAT
TTGGGTGAATGCCCAAGAGATGATGCTTGTACAAGGAAATTTTACTTTTTTGTTGCAATA
CAAGTCTTGAATTTATTTTTCTCTGCACTTGGAGGCACCTCACATGTCATGCTGATTGTT
AAAATTGTTCAACCTGAATTGAAATCACTTGCACTGGGTTTCCACTCAATGGTTATACGA
GCACTAGGAGGAATTCTAGCTCCAATATATTTTGGGGCTCTGATTGATACAACGTGTATA
AAGTGGTCCACCAACAACTGTGGCACACGTGGGTCATGTAGGACATATAATTCCACATCA
TTTTCAAGGGTCTACTTGGGCTTGTCTTCAATGTTAAGAGTCTCATCACTTGTTTTATAT
ATTATATTAATTTATGCCATGAAGAAAAAATATCAAGAGAAAGATATCAATGCATCAGAA
AATGGAAGTGTCATGGATGAAGCAAACTTAGAATCCTTAAATAAAAATAAACATTTTGTC
CCTTCTGCTGGGGCAGATAGTGAAACACATTGT


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SLCO1B1
Symbol Nomenclature : SLCO1B1
SYNONYM : HBLRR; LST-1; LST1; OATP-C; OATP1B1; OATP2; OATPC; SLC21A6
Designation : OATP-2|liver-specific organic anion transporter 1|sodium-independent organic anion-transporting polypeptide 2|solute carrier family 21 (organic anion transporter), member 6|solute carrier family 21 member 6|solute carrier organic anion transporter family member 1B1
Full Nomenclature : solute carrier organic anion transporter family, member 1B1
GENEID : 10599
HGNC : 10959
MIM : 604843
Vega : OTTHUMG00000169047
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00443578      ATGGACCAAAATCAACATTTGAATAAAACAGCAGAGGCACAACCTTCAGAGAATAAGAAA
NM_006446.4       ATGGACCAAAATCAACATTTGAATAAAACAGCAGAGGCACAACCTTCAGAGAATAAGAAA
                  ************************************************************

HsCD00443578      ACAAGATACTGCAATGGATTGAAGATGTTCTTGGCAGCTCTGTCACTCAGCTTTATTGCT
NM_006446.4       ACAAGATACTGCAATGGATTGAAGATGTTCTTGGCAGCTCTGTCACTCAGCTTTATTGCT
                  ************************************************************

HsCD00443578      AAGACACTAGGTGCAATTATTATGAAAAGTTCCATCATTCATATAGAACGGAGATTTGAG
NM_006446.4       AAGACACTAGGTGCAATTATTATGAAAAGTTCCATCATTCATATAGAACGGAGATTTGAG
                  ************************************************************

HsCD00443578      ATATCCTCTTCTCTTGTTGGTTTTATTGACGGAAGCTTTGAAATTGGAAATTTGCTTGTG
NM_006446.4       ATATCCTCTTCTCTTGTTGGTTTTATTGACGGAAGCTTTGAAATTGGAAATTTGCTTGTG
                  ************************************************************

HsCD00443578      ATTGTATTTGTGAGTTACTTTGGATCCAAACTACATAGACCAAAGTTAATTGGAATCGGT
NM_006446.4       ATTGTATTTGTGAGTTACTTTGGATCCAAACTACATAGACCAAAGTTAATTGGAATCGGT
                  ************************************************************

HsCD00443578      TGTTTCATTATGGGAATTGGAGGTGTTTTGACTGCTTTGCCACATTTCTTCATGGGATAT
NM_006446.4       TGTTTCATTATGGGAATTGGAGGTGTTTTGACTGCTTTGCCACATTTCTTCATGGGATAT
                  ************************************************************

HsCD00443578      TACAGGTATTCTAAAGAAACTAATATCGATTCATCAGAAAATTCAACATCAACCTTATCC
NM_006446.4       TACAGGTATTCTAAAGAAACTAATATCAATTCATCAGAAAATTCAACATCGACCTTATCC
                  ***************************.**********************.*********

HsCD00443578      ACTTGTTTAATTAATCAAATTTTATCACTCAATAGAGCATCAACTGAGATAGTGGGAAAA
NM_006446.4       ACTTGTTTAATTAATCAAATTTTATCACTCAATAGAGCATCACCTGAGATAGTGGGAAAA
                  ******************************************.*****************

HsCD00443578      GGTTGTTTAAAGGAATCTGGGTCATACATGTGGATATATGTGTTCATGGGTAATATGCTT
NM_006446.4       GGTTGTTTAAAGGAATCTGGGTCATACATGTGGATATATGTGTTCATGGGTAATATGCTT
                  ************************************************************

HsCD00443578      CGTGGAATAGGGGAGACTCCCATAGTACCACTGGGGCTTTCTTACATTGATGATTTTGCT
NM_006446.4       CGTGGAATAGGGGAGACTCCCATAGTACCATTGGGGCTTTCTTACATTGATGATTTCGCT
                  ****************************** ************************* ***

HsCD00443578      AAAGAAGGACATTCTTCTTTGTATTTAGGTATATTGAATGCAATAGCAATGATTGGTCCA
NM_006446.4       AAAGAAGGACATTCTTCTTTGTATTTAGGTATATTGAATGCAATAGCAATGATTGGTCCA
                  ************************************************************

HsCD00443578      ATCATTGGCTTTACCCTGGGATCTCTGTTTTCTAAAATGTACGTGGATATTGGATATGTA
NM_006446.4       ATCATTGGCTTTACCCTGGGATCTCTGTTTTCTAAAATGTACGTGGATATTGGATATGTA
                  ************************************************************

HsCD00443578      GATCTAAGCACTATCAGGATAACTCCTACTGATTCTCGATGGGTTGGAGCTTGGTGGCTT
NM_006446.4       GATCTAAGCACTATCAGGATAACTCCTACTGATTCTCGATGGGTTGGAGCTTGGTGGCTT
                  ************************************************************

HsCD00443578      AATTTCCTTGTGTCTGGACTATTCTCCATTATTTCTTCCATACCATTCTTTTTCTTGCCC
NM_006446.4       AATTTCCTTGTGTCTGGACTATTCTCCATTATTTCTTCCATACCATTCTTTTTCTTGCCC
                  ************************************************************

HsCD00443578      CAAACTCCAAATAAACCACAAAAAGAAAGAAAAGCTTCACTGTCTTTGCATGTGCTGGAA
NM_006446.4       CAAACTCCAAATAAACCACAAAAAGAAAGAAAAGCTTCACTGTCTTTGCATGTGCTGGAA
                  ************************************************************

HsCD00443578      ACAAATGATGAAAAGGATCAAACAGCTAATTTGACCAATCAAGGAAAAAATATTACCAAA
NM_006446.4       ACAAATGATGAAAAGGATCAAACAGCTAATTTGACCAATCAAGGAAAAAATATTACCAAA
                  ************************************************************

HsCD00443578      AATGTGACTGGTTTTTTCCAGTCTTTTAAAAGCATCCTTACTAATCCCCTGTATGTTATG
NM_006446.4       AATGTGACTGGTTTTTTCCAGTCTTTTAAAAGCATCCTTACTAATCCCCTGTATGTTATG
                  ************************************************************

HsCD00443578      TTTGTGCTTTTGACGTTGTTACAAGTAAGCAGCTATATTGGTGCTTTTACTTATGTCTTC
NM_006446.4       TTTGTGCTTTTGACGTTGTTACAAGTAAGCAGCTATATTGGTGCTTTTACTTATGTCTTC
                  ************************************************************

HsCD00443578      AAATACGTAGAGCAACAGTATGGTCAGCCTTCATCTAAGGCTAACATCTTATTGGGAGTC
NM_006446.4       AAATACGTAGAGCAACAGTATGGTCAGCCTTCATCTAAGGCTAACATCTTATTGGGAGTC
                  ************************************************************

HsCD00443578      ATAACCATACCTATTTTTGCAAGTGGAATGTTTTTAGGAGGATATATCATTAAAAAATTC
NM_006446.4       ATAACCATACCTATTTTTGCAAGTGGAATGTTTTTAGGAGGATATATCATTAAAAAATTC
                  ************************************************************

HsCD00443578      AAACTGAACACCGTTGGAATTGCCAAATTCTCATGTTTTACTGCTGTGATGTCATTGTCC
NM_006446.4       AAACTGAACACCGTTGGAATTGCCAAATTCTCATGTTTTACTGCTGTGATGTCATTGTCC
                  ************************************************************

HsCD00443578      TTTTACCTATTATATTTTTTCATACTCTGTGAAAACAAATCAGTTGCCGGACTAACCATG
NM_006446.4       TTTTACCTATTATATTTTTTCATACTCTGTGAAAACAAATCAGTTGCCGGACTAACCATG
                  ************************************************************

HsCD00443578      ACCTATGATGGAAATAATCCAGTGACATCTCATAGAGATGTACCACTTTCTTATTGCAAC
NM_006446.4       ACCTATGATGGAAATAATCCAGTGACATCTCATAGAGATGTACCACTTTCTTATTGCAAC
                  ************************************************************

HsCD00443578      TCAGACTGCAATTGTGATGAAAGTCAATGGGAACCAGTCTGTGGAAACAATGGAATAACT
NM_006446.4       TCAGACTGCAATTGTGATGAAAGTCAATGGGAACCAGTCTGTGGAAACAATGGAATAACT
                  ************************************************************

HsCD00443578      TACATCTCACCCTGTCTAGCAGGTTGCAAATCTTCAAGTGGCAATAAAAAGCCTATAGTG
NM_006446.4       TACATCTCACCCTGTCTAGCAGGTTGCAAATCTTCAAGTGGCAATAAAAAGCCTATAGTG
                  ************************************************************

HsCD00443578      TTTTACAACTGCAGTTGTTTGGAAGTAACTGGTCTCCAGAACAGAAATTACTCAGCCCAT
NM_006446.4       TTTTACAACTGCAGTTGTTTGGAAGTAACTGGTCTCCAGAACAGAAATTACTCAGCCCAT
                  ************************************************************

HsCD00443578      TTGGGTGAATGCCCAAGAGATGATGCTTGTACAAGGAAATTTTACTTTTTTGTTGCAATA
NM_006446.4       TTGGGTGAATGCCCAAGAGATGATGCTTGTACAAGGAAATTTTACTTTTTTGTTGCAATA
                  ************************************************************

HsCD00443578      CAAGTCTTGAATTTATTTTTCTCTGCACTTGGAGGCACCTCACATGTCATGCTGATTGTT
NM_006446.4       CAAGTCTTGAATTTATTTTTCTCTGCACTTGGAGGCACCTCACATGTCATGCTGATTGTT
                  ************************************************************

HsCD00443578      AAAATTGTTCAACCTGAATTGAAATCACTTGCACTGGGTTTCCACTCAATGGTTATACGA
NM_006446.4       AAAATTGTTCAACCTGAATTGAAATCACTTGCACTGGGTTTCCACTCAATGGTTATACGA
                  ************************************************************

HsCD00443578      GCACTAGGAGGAATTCTAGCTCCAATATATTTTGGGGCTCTGATTGATACAACGTGTATA
NM_006446.4       GCACTAGGAGGAATTCTAGCTCCAATATATTTTGGGGCTCTGATTGATACAACGTGTATA
                  ************************************************************

HsCD00443578      AAGTGGTCCACCAACAACTGTGGCACACGTGGGTCATGTAGGACATATAATTCCACATCA
NM_006446.4       AAGTGGTCCACCAACAACTGTGGCACACGTGGGTCATGTAGGACATATAATTCCACATCA
                  ************************************************************

HsCD00443578      TTTTCAAGGGTCTACTTGGGCTTGTCTTCAATGTTAAGAGTCTCATCACTTGTTTTATAT
NM_006446.4       TTTTCAAGGGTCTACTTGGGCTTGTCTTCAATGTTAAGAGTCTCATCACTTGTTTTATAT
                  ************************************************************

HsCD00443578      ATTATATTAATTTATGCCATGAAGAAAAAATATCAAGAGAAAGATATCAATGCATCAGAA
NM_006446.4       ATTATATTAATTTATGCCATGAAGAAAAAATATCAAGAGAAAGATATCAATGCATCAGAA
                  ************************************************************

HsCD00443578      AATGGAAGTGTCATGGATGAAGCAAACTTAGAATCCTTAAATAAAAATAAACATTTTGTC
NM_006446.4       AATGGAAGTGTCATGGATGAAGCAAACTTAGAATCCTTAAATAAAAATAAACATTTTGTC
                  ************************************************************

HsCD00443578      CCTTCTGCTGGGGCAGATAGTGAAACACATTGT---
NM_006446.4       CCTTCTGCTGGGGCAGATAGTGAAACACATTGTTAA
                  *********************************   

Pathways

Reactome : Bile acid and bile salt metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Recycling of bile acids and salts
Reactome : SLC-mediated transmembrane transport
Reactome : Transmembrane transport of small molecules
Reactome : Transport of organic anions
Reactome : Transport of vitamins, nucleosides, and related molecules
WikiPathway : Codeine and morphine metabolism

Protein

SMART domain : KAZAL : Kazal type serine protease inhibitors
HPRD : 09214

Clone

Original Clone ID : ccsbBroad304_07645

Organism


TAX_ID : 9606
Species Specific ID: 10599

Genome

Chromosome : 12
Map Location : 12p
Ensembl : ENSG00000134538

Reagents

Labome : SLCO1B1-antibody