DNASU Plasmid Repository • 480.965.5697 | Email

PRPF19 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRPF19
Gene Name:  pre-mRNA processing factor 19
Sequence             
Original Clone ID: ccsbBroad304_03033
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00445136

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1513nts         Open reading frame : 1 to 1513
Reference Sequence Alignment

ATGTCCCTAATCTGCTCCATCTCTAACGAAGTGCCGGAGCACCCATGTGTATCCCCTGTC
TCTAATCATGTTTATGAGCGGCGGCTCATCGAGAAGTACATTGCGGAGAATGGTACCGAC
CCCATCAACAACCAGCCTCTCTCCGAGGAGCAGCTCATCGACATCAAAGTTGCTCACCCA
ATCCGGCCCAAGCCTCCCTCAGCCACCAGCATCCCGGCCATTCTGAAAGCTTTGCAGGAT
GAGTGGGATGCAGTCATGCTGCACAGCTTCACTCTGCGCCAGCAGCTGCAGACAACCCGC
CAAGAGCTGTCACACGCTCTGTACCAGCACGATGCCGCCTGCCGTGTCATTGCCCGTCTC
ACCAAGGAAGTCACTGCTGCCCGAGAAGCTCTGGCTACCCTGAAACCACAGGCTGGCCTC
ATTGTGCCCCAGGCTGTGCCAAGTTCCCAACCAAGTGTTGTGGGTGCGGGTGAGCCAATG
GATTTGGGTGAGCTGGTGGGAATGACCCCAGAGATTATTCAGAAGCTTCAAGACAAAGCC
ACTGTGCTAACCACGGAGCGCAAGAAGAGAGGGAAGACTGTGCCTGAGGAGCTGGTGAAG
CCAGAAGAGCTCAGCAAATACCGGCAGGTGGCATCCCACGTGGGGTTGCACAGTGCCAGC
ATTCCTGGGATCCTGGCCCTGGACCTCTGCCCGTCCGACACCAACAAGATCCTCACTGGT
GGGGCGGATAAAAATGTCGTTGTGTTTGACAAAAGTTCTGAACAAATCCTGGCTACCCTC
AAAGGCCATACCAAGAAGGTCACCAGCGTGGTGTTTCACCCTTCCCAGGACCTGGTGTTT
TCTGCTTCCCCCGATGCCACTATCAGGATTTGGTCGGTCCCCAATGCCTCTTGTGTACAG
GTGGTTCGGGCCCATGAGAGTGCTGTGACAGGCCTCAGCCTTCATGCCACTGGCGACTAT
CTCCTGAGCTCCTCCGATGATCAGTACTGGGCTTTCTCTGACATCCAGACAGGGCGTGTG
CTCACCAAGGTGACAGATGAGACCTCCGGCTGCTCTCTCACCTGTGCACAGTTCCACCCT
GACGGACTCATCTTTGGAACAGGAACCATGGACTCTCAGATCAAGATCTGGGACTTGAAG
GAACGTACTAATGTGGCCAACTTCCCTGGCCACTCGGGCCCCATCACTAGCATCGCCTTC
TCTGAGAATGGTTACTACCTGGCTACAGCGGCTGATGACTCCTCTGTCAAGCTCTGGGAT
CTGCGCAAGCTTAAGAACTTTAAGACTTTGCAGCTGGATAACAACTTTGAGGTAAAGTCA
CTGATCTTTGACCAGAGTGGTACCTACCTGGCTCTTGGGGGCACGGATGTCCAGATCTAC
ATCTGCAAACAATGGACGGAGATTCTTCACTTTACAGAGCATAGCGGCCTGACCACAGGG
GTGGCCTTCGGGCATCACGCCAAGTTCATCGCTTCAACAGGCATGGACAGAAGCCTCAAG
TTCTACAGCCTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRPF19
Symbol Nomenclature : PRPF19
SYNONYM : NMP200; PRP19; PSO4; SNEV; UBOX4; hPSO4
Designation : PRP19/PSO4 homolog|PRP19/PSO4 pre-mRNA processing factor 19 homolog|nuclear matrix protein 200|nuclear matrix protein NMP200 related to splicing factor PRP19|pre-mRNA-processing factor 19|senescence evasion factor
Full Nomenclature : pre-mRNA processing factor 19
GENEID : 27339
GenBank Accession : DQ896249
HGNC : 17896
MIM : 608330
Vega : OTTHUMG00000167798
Target GenBank: DQ896249

 

Reference Sequence Alignment

  

HsCD00445136      ATGTCCCTAATCTGCTCCATCTCTAACGAAGTGCCGGAGCACCCATGTGTATCCCCTGTC
NM_014502.4       ATGTCCCTAATCTGCTCCATCTCTAACGAAGTGCCGGAGCACCCATGTGTATCCCCTGTC
                  ************************************************************

HsCD00445136      TCTAATCATGTTTATGAGCGGCGGCTCATCGAGAAGTACATTGCGGAGAATGGTACCGAC
NM_014502.4       TCTAATCATGTTTATGAGCGGCGGCTCATCGAGAAGTACATTGCGGAGAATGGTACCGAC
                  ************************************************************

HsCD00445136      CCCATCAACAACCAGCCTCTCTCCGAGGAGCAGCTCATCGACATCAAAGTTGCTCACCCA
NM_014502.4       CCCATCAACAACCAGCCTCTCTCCGAGGAGCAGCTCATCGACATCAAAGTTGCTCACCCA
                  ************************************************************

HsCD00445136      ATCCGGCCCAAGCCTCCCTCAGCCACCAGCATCCCGGCCATTCTGAAAGCTTTGCAGGAT
NM_014502.4       ATCCGGCCCAAGCCTCCCTCAGCCACCAGCATCCCGGCCATTCTGAAAGCTTTGCAGGAT
                  ************************************************************

HsCD00445136      GAGTGGGATGCAGTCATGCTGCACAGCTTCACTCTGCGCCAGCAGCTGCAGACAACCCGC
NM_014502.4       GAGTGGGATGCAGTCATGCTGCACAGCTTCACTCTGCGCCAGCAGCTGCAGACAACCCGC
                  ************************************************************

HsCD00445136      CAAGAGCTGTCACACGCTCTGTACCAGCACGATGCCGCCTGCCGTGTCATTGCCCGTCTC
NM_014502.4       CAAGAGCTGTCACACGCTCTGTACCAGCACGATGCCGCCTGCCGTGTCATTGCCCGTCTC
                  ************************************************************

HsCD00445136      ACCAAGGAAGTCACTGCTGCCCGAGAAGCTCTGGCTACCCTGAAACCACAGGCTGGCCTC
NM_014502.4       ACCAAGGAAGTCACTGCTGCCCGAGAAGCTCTGGCTACCCTGAAACCACAGGCTGGCCTC
                  ************************************************************

HsCD00445136      ATTGTGCCCCAGGCTGTGCCAAGTTCCCAACCAAGTGTTGTGGGTGCGGGTGAGCCAATG
NM_014502.4       ATTGTGCCCCAGGCTGTGCCAAGTTCCCAACCAAGTGTTGTGGGTGCGGGTGAGCCAATG
                  ************************************************************

HsCD00445136      GATTTGGGTGAGCTGGTGGGAATGACCCCAGAGATTATTCAGAAGCTTCAAGACAAAGCC
NM_014502.4       GATTTGGGTGAGCTGGTGGGAATGACCCCAGAGATTATTCAGAAGCTTCAAGACAAAGCC
                  ************************************************************

HsCD00445136      ACTGTGCTAACCACGGAGCGCAAGAAGAGAGGGAAGACTGTGCCTGAGGAGCTGGTGAAG
NM_014502.4       ACTGTGCTAACCACGGAGCGCAAGAAGAGAGGGAAGACTGTGCCTGAGGAGCTGGTGAAG
                  ************************************************************

HsCD00445136      CCAGAAGAGCTCAGCAAATACCGGCAGGTGGCATCCCACGTGGGGTTGCACAGTGCCAGC
NM_014502.4       CCAGAAGAGCTCAGCAAATACCGGCAGGTGGCATCCCACGTGGGGTTGCACAGTGCCAGC
                  ************************************************************

HsCD00445136      ATTCCTGGGATCCTGGCCCTGGACCTCTGCCCGTCCGACACCAACAAGATCCTCACTGGT
NM_014502.4       ATTCCTGGGATCCTGGCCCTGGACCTCTGCCCGTCCGACACCAACAAGATCCTCACTGGT
                  ************************************************************

HsCD00445136      GGGGCGGATAAAAATGTCGTTGTGTTTGACAAAAGTTCTGAACAAATCCTGGCTACCCTC
NM_014502.4       GGGGCGGATAAAAATGTCGTTGTGTTTGACAAAAGTTCTGAACAAATCCTGGCTACCCTC
                  ************************************************************

HsCD00445136      AAAGGCCATACCAAGAAGGTCACCAGCGTGGTGTTTCACCCTTCCCAGGACCTGGTGTTT
NM_014502.4       AAAGGCCATACCAAGAAGGTCACCAGCGTGGTGTTTCACCCTTCCCAGGACCTGGTGTTT
                  ************************************************************

HsCD00445136      TCTGCTTCCCCCGATGCCACTATCAGGATTTGGTCGGTCCCCAATGCCTCTTGTGTACAG
NM_014502.4       TCTGCTTCCCCCGATGCCACTATCAGGATTTGGTCGGTCCCCAATGCCTCTTGTGTACAG
                  ************************************************************

HsCD00445136      GTGGTTCGGGCCCATGAGAGTGCTGTGACAGGCCTCAGCCTTCATGCCACTGGCGACTAT
NM_014502.4       GTGGTTCGGGCCCATGAGAGTGCTGTGACAGGCCTCAGCCTTCATGCCACTGGCGACTAT
                  ************************************************************

HsCD00445136      CTCCTGAGCTCCTCCGATGATCAGTACTGGGCTTTCTCTGACATCCAGACAGGGCGTGTG
NM_014502.4       CTCCTGAGCTCCTCCGATGATCAGTACTGGGCTTTCTCTGACATCCAGACAGGGCGTGTG
                  ************************************************************

HsCD00445136      CTCACCAAGGTGACAGATGAGACCTCCGGCTGCTCTCTCACCTGTGCACAGTTCCACCCT
NM_014502.4       CTCACCAAGGTGACAGATGAGACCTCCGGCTGCTCTCTCACCTGTGCACAGTTCCACCCT
                  ************************************************************

HsCD00445136      GACGGACTCATCTTTGGAACAGGAACCATGGACTCTCAGATCAAGATCTGGGACTTGAAG
NM_014502.4       GACGGACTCATCTTTGGAACAGGAACCATGGACTCTCAGATCAAGATCTGGGACTTGAAG
                  ************************************************************

HsCD00445136      GAACGTACTAATGTGGCCAACTTCCCTGGCCACTCGGGCCCCATCACTAGCATCGCCTTC
NM_014502.4       GAACGTACTAATGTGGCCAACTTCCCTGGCCACTCGGGCCCCATCACTAGCATCGCCTTC
                  ************************************************************

HsCD00445136      TCTGAGAATGGTTACTACCTGGCTACAGCGGCTGATGACTCCTCTGTCAAGCTCTGGGAT
NM_014502.4       TCTGAGAATGGTTACTACCTGGCTACAGCGGCTGATGACTCCTCTGTCAAGCTCTGGGAT
                  ************************************************************

HsCD00445136      CTGCGCAAGCTTAAGAACTTTAAGACTTTGCAGCTGGATAACAACTTTGAGGTAAAGTCA
NM_014502.4       CTGCGCAAGCTTAAGAACTTTAAGACTTTGCAGCTGGATAACAACTTTGAGGTAAAGTCA
                  ************************************************************

HsCD00445136      CTGATCTTTGACCAGAGTGGTACCTACCTGGCTCTTGGGGGCACGGATGTCCAGATCTAC
NM_014502.4       CTGATCTTTGACCAGAGTGGTACCTACCTGGCTCTTGGGGGCACGGATGTCCAGATCTAC
                  ************************************************************

HsCD00445136      ATCTGCAAACAATGGACGGAGATTCTTCACTTTACAGAGCATAGCGGCCTGACCACAGGG
NM_014502.4       ATCTGCAAACAATGGACGGAGATTCTTCACTTTACAGAGCATAGCGGCCTGACCACAGGG
                  ************************************************************

HsCD00445136      GTGGCCTTCGGGCATCACGCCAAGTTCATCGCTTCAACAGGCATGGACAGAAGCCTCAAG
NM_014502.4       GTGGCCTTCGGGCATCACGCCAAGTTCATCGCTTCAACAGGCATGGACAGAAGCCTCAAG
                  ************************************************************

HsCD00445136      TTCTACAGCCTG---
NM_014502.4       TTCTACAGCCTGTAG
                  ************   

Protein

SMART domain : WD40 : WD40 repeats
SMART domain : Ubox : Modified RING finger domain
HPRD : 12214

Clone

Original Clone ID : ccsbBroad304_03033

Organism


TAX_ID : 9606
Species Specific ID: 27339

Genome

Chromosome : 11
Map Location : 11q12.2
Ensembl : ENSG00000110107

Reagents

Labome : PRPF19-antibody