DNASU Plasmid Repository • 480.965.5697 | Email

PPP3CC (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPP3CC
Gene Name:  protein phosphatase 3, catalytic subunit, gamma isozyme
Sequence             
Original Clone ID: ccsbBroad304_06761
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00445142

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1537nts         Open reading frame : 1 to 1537
Reference Sequence Alignment

ATGTCCGGGAGGCGCTTCCACCTCTCCACCACCGACCGCGTCATCAAAGCTGTCCCCTTT
CCTCCAACCCAACGGCTTACTTTCAAGGAAGTATTTGAGAATGGGAAACCTAAAGTTGAT
GTTTTAAAAAACCATTTGGTAAAGGAAGGACGACTGGAAGAGGAAGTAGCCTTAAAGATA
ATCAATGATGGGGCTGCCATCCTGAGGCAAGAGAAGACTATGATAGAAGTAGATGCTCCA
ATCACAGTATGTGGTGATATTCATGGACAATTCTTTGACCTAATGAAGTTATTTGAAGTT
GGAGGATCACCTAGTAACACACGCTACCTCTTTCTGGGTGACTATGTGGACAGAGGCTAT
TTCAGTATAGAGTGTGTGCTGTATTTATGGAGTTTAAAGATTAATCATCCCAAAACATTG
TTTCTGCTTCGGGGAAATCATGAATGCAGGCATCTTACAGACTATTTCACCTTCAAACAG
GAATGTCGAATCAAATATTCGGAACAGGTGTATGATGCCTGTATGGAGACATTTGACTGT
CTTCCTCTTGCTGCCCTCTTAAACCAGCAGTTTCTCTGTGTACATGGAGGAATGTCACCT
GAAATTACTTCTTTAGATGACATTAGGAAATTAGACAGGTTTACGGAACCTCCCGCCTTT
GGACCTGTGTGTGACCTGCTTTGGTCTGATCCCTCAGAGGATTATGGCAATGAGAAGACC
TTGGAGCACTATACCCACAACACTGTCCGAGGGTGCTCTTATTTCTACAGTTACCCTGCA
GTTTGTGAATTTTTGCAGAACAATAATTTACTATCAATTATCAGAGCCCATGAAGCCCAA
GATGCTGGGTATCGAATGTACAGGAAGAGCCAAGCCACAGGCTTTCCATCACTTATTACA
ATTTTCTCTGCCCCCAATTACCTAGATGTCTATAACAATAAAGCTGCTGTGTTGAAATAT
GAAAACAATGTCATGAATATCAGGCAGTTTAACTGTTCTCCACACCCCTACTGGCTTCCA
AACTTTATGGATGTTTTCACATGGTCTTTGCCTTTTGTTGGGGAAAAAGTCACAGAGATG
CTGGTAAATGTGCTCAACATATGCTCTGATGACGAACTGATTTCTGATGATGAAGCAGAA
GGAAGCACTACAGTTCGTAAGGAGATCATCAGGAATAAGATCAGAGCCATTGGGAAGATG
GCACGGGTCTTTTCAATTCTTCGGCAAGAAAGTGAGAGTGTGCTGACTCTCAAGGGCCTG
ACTCCCACAGGCACACTCCCTCTGGGCGTCCTCTCAGGAGGCAAGCAGACTATCGAGACA
GCCACAGTAGAAGCGGTAGAGGCCCGGGAAGCCATCAGAGGGTTCTCGCTTCAGCACAAG
ATCCGGAGTTTTGAAGAAGCGCGAGGTCTGGACCGAATTAATGAGCGAATGCCACCCCGA
AAGGATAGCATACACGCTGGTGGGCCAATGAAATCTGTAACCTCAGCACACTCACATGCT
GCGCACAGGAGCGACCAAGGGAAAAAAGCCCATTCA


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
1 error
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPP3CC
Symbol Nomenclature : PPP3CC
SYNONYM : CALNA3; CNA3; PP2Bgamma
Designation : CAM-PRP catalytic subunit|calcineurin, testis-specific catalytic subunit|calmodulin-dependent calcineurin A subunit gamma isoform|protein phosphatase 2B, catalytic subunit, gamma isoform|protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform|serine/threonine-protein phosphatase 2B catalytic subunit gamma isoform
Full Nomenclature : protein phosphatase 3, catalytic subunit, gamma isozyme
GENEID : 5533
GenBank Accession : HQ448368
HGNC : 9316
MIM : 114107
Vega : OTTHUMG00000163802
Target GenBank: HQ448368

 

Reference Sequence Alignment

  

HsCD00445142        ATGTCCGGGAGGCGCTTCCACCTCTCCACCACCGACCGCGTCATCAAAGCTGTCCCCTTT
NM_001243974.1      ATGTCCGGGAGGCGCTTCCACCTCTCCACCACCGACCGCGTCATCAAAGCTGTCCCCTTT
XM_005273564.1      ATGTCCGGGAGGCGCTTCCACCTCTCCACCACCGACCGCGTCATCAAAGCTGTCCCCTTT
NM_005605.4         ATGTCCGGGAGGCGCTTCCACCTCTCCACCACCGACCGCGTCATCAAAGCTGTCCCCTTT
NM_001243975.1      ATGTCCGGGAGGCGCTTCCACCTCTCCACCACCGACCGCGTCATCAAAGCTGTCCCCTTT
                    ************************************************************

HsCD00445142        CCTCCAACCCAACGGCTTACTTTCAAGGAAGTATTTGAGAATGGGAAACCTAAAGTTGAT
NM_001243974.1      CCTCCAACCCAACGGCTTACTTTCAAGGAAGTATTTGAGAATGGGAAACCTAAAGTTGAT
XM_005273564.1      CCTCCAACCCAACGGCTTACTTTCAAGGAAGTATTTGAGAATGGGAAACCTAAAGTTGAT
NM_005605.4         CCTCCAACCCAACGGCTTACTTTCAAGGAAGTATTTGAGAATGGGAAACCTAAAGTTGAT
NM_001243975.1      CCTCCAACCCAACGGCTTACTTTCAAGGAAGTATTTGAGAATGGGAAACCTAAAGTTGAT
                    ************************************************************

HsCD00445142        GTTTTAAAAAACCATTTGGTAAAGGAAGGACGACTGGAAGAGGAAGTAGCCTTAAAGATA
NM_001243974.1      GTTTTAAAAAACCATTTGGTAAAGGAAGGACGACTGGAAGAGGAAGTAGCCTTAAAGATA
XM_005273564.1      GTTTTAAAAAACCATTTGGTAAAGGAAGGACGACTGGAAGAGGAAGTAGCCTTAAAGATA
NM_005605.4         GTTTTAAAAAACCATTTGGTAAAGGAAGGACGACTGGAAGAGGAAGTAGCCTTAAAGATA
NM_001243975.1      GTTTTAAAAAACCATTTGGTAAAGGAAGGACGACTGGAAGAGGAAGTAGCCTTAAAGATA
                    ************************************************************

HsCD00445142        ATCAATGATGGGGCTGCCATCCTGAGGCAAGAGAAGACTATGATAGAAGTAGATGCTCCA
NM_001243974.1      ATCAATGATGGGGCTGCCATCCTGAGGCAAGAGAAGACTATGATAGAAGTAGATGCTCCA
XM_005273564.1      ATCAATGATGGGGCTGCCATCCTGAGGCAAGAGAAGACTATGATAGAAGTAGATGCTCCA
NM_005605.4         ATCAATGATGGGGCTGCCATCCTGAGGCAAGAGAAGACTATGATAGAAGTAGATGCTCCA
NM_001243975.1      ATCAATGATGGGGCTGCCATCCTGAGGCAAGAGAAGACTATGATAGAAGTAGATGCTCCA
                    ************************************************************

HsCD00445142        ATCACAGTATGTGGTGATATTCATGGACAATTCTTTGACCTAATGAAGTTATTTGAAGTT
NM_001243974.1      ATCACAGTATGTGGTGATATTCATGGACAATTCTTTGACCTAATGAAGTTATTTGAAGTT
XM_005273564.1      ATCACAGTATGTGGTGATATTCATGGACAATTCTTTGACCTAATGAAGTTATTTGAAGTT
NM_005605.4         ATCACAGTATGTGGTGATATTCATGGACAATTCTTTGACCTAATGAAGTTATTTGAAGTT
NM_001243975.1      ATCACAGTATGTGGTGATATTCATGGACAATTCTTTGACCTAATGAAGTTATTTGAAGTT
                    ************************************************************

HsCD00445142        GGAGGATCACCTAGTAACACACGCTACCTCTTTCTGGGTGACTATGTGGACAGAGGCTAT
NM_001243974.1      GGAGGATCACCTAGTAACACACGCTACCTCTTTCTGGGTGACTATGTGGACAGAGGCTAT
XM_005273564.1      GGAGGATCACCTAGTAACACACGCTACCTCTTTCTGGGTGACTATGTGGACAGAGGCTAT
NM_005605.4         GGAGGATCACCTAGTAACACACGCTACCTCTTTCTGGGTGACTATGTGGACAGAGGCTAT
NM_001243975.1      GGAGGATCACCTAGTAACACACGCTACCTCTTTCTGGGTGACTATGTGGACAGAGGCTAT
                    ************************************************************

HsCD00445142        TTCAGTATAGAGTGTGTGCTGTATTTATGGAGTTTAAAGATTAATCATCCCAAAACATTG
NM_001243974.1      TTCAGTATAGAGTGTGTGCTGTATTTATGGAGTTTAAAGATTAATCATCCCAAAACATTG
XM_005273564.1      TTCAGTATAGAGTGTGTGCTGTATTTATGGAGTTTAAAGATTAATCATCCCAAAACATTG
NM_005605.4         TTCAGTATAGAGTGTGTGCTGTATTTATGGAGTTTAAAGATTAATCATCCCAAAACATTG
NM_001243975.1      TTCAGTATAGAGTGTGTGCTGTATTTATGGAGTTTAAAGATTAATCATCCCAAAACATTG
                    ************************************************************

HsCD00445142        TTTCTGCTTCGGGGAAATCATGAATGCAGGCATCTTACAGACTATTTCACCTTCAAACAG
NM_001243974.1      TTTCTGCTTCGGGGAAATCATGAATGCAGGCATCTTACAGACTATTTCACCTTCAAACAG
XM_005273564.1      TTTCTGCTTCGGGGAAATCATGAATGCAGGCATCTTACAGACTATTTCACCTTCAAACAG
NM_005605.4         TTTCTGCTTCGGGGAAATCATGAATGCAGGCATCTTACAGACTATTTCACCTTCAAACAG
NM_001243975.1      TTTCTGCTTCGGGGAAATCATGAATGCAGGCATCTTACAGACTATTTCACCTTCAAACAG
                    ************************************************************

HsCD00445142        GAATGTCGAATCAAATATTCGGAACAGGTGTATGATGCCTGTATGGAGACATTTGACTGT
NM_001243974.1      GAATGTCGAATCAAATATTCGGAACAGGTGTATGATGCCTGTATGGAGACATTTGACTGT
XM_005273564.1      GAATGTCGAATCAAATATTCGGAACAGGTGTATGATGCCTGTATGGAGACATTTGACTGT
NM_005605.4         GAATGTCGAATCAAATATTCGGAACAGGTGTATGATGCCTGTATGGAGACATTTGACTGT
NM_001243975.1      GAATGTCGAATCAAATATTCGGAACAGGTGTATGATGCCTGTATGGAGACATTTGACTGT
                    ************************************************************

HsCD00445142        CTTCCTCTTGCTGCCCTCTTAAACCAGCAGTTTCTCTGTGTACATGGAGGAATGTCACCT
NM_001243974.1      CTTCCTCTTGCTGCCCTCTTAAACCAGCAGTTTCTCTGTGTACATGGAGGAATGTCACCT
XM_005273564.1      CTTCCTCTTGCTGCCCTCTTAAACCAGCAGTTTCTCTGTGTACATGGAGGAATGTCACCT
NM_005605.4         CTTCCTCTTGCTGCCCTCTTAAACCAGCAGTTTCTCTGTGTACATGGAGGAATGTCACCT
NM_001243975.1      CTTCCTCTTGCTGCCCTCTTAAACCAGCAGTTTCTCTGTGTACATGGAGGAATGTCACCT
                    ************************************************************

HsCD00445142        GAAATTACTTCTTTAGATGACATTAGGAAATTAGACAGGTTTACGGAACCTCCCGCCTTT
NM_001243974.1      GAAATTACTTCTTTAGATGACATTAGGAAATTAGACAGGTTTACGGAACCTCCCGCCTTT
XM_005273564.1      GAAATTACTTCTTTAGATGACATTAGGAAATTAGACAGGTTTACGGAACCTCCCGCCTTT
NM_005605.4         GAAATTACTTCTTTAGATGACATTAGGAAATTAGACAGGTTTACGGAACCTCCCGCCTTT
NM_001243975.1      GAAATTACTTCTTTAGATGACATTAGGAAATTAGACAGGTTTACGGAACCTCCCGCCTTT
                    ************************************************************

HsCD00445142        GGACCTGTGTGTGACCTGCTTTGGTCTGATCCCTCAGAGGATTATGGCAATGAGAAGACC
NM_001243974.1      GGACCTGTGTGTGACCTGCTTTGGTCTGATCCCTCAGAGGATTATGGCAATGAGAAGACC
XM_005273564.1      GGACCTGTGTGTGACCTGCTTTGGTCTGATCCCTCAGAGGATTATGGCAATGAGAAGACC
NM_005605.4         GGACCTGTGTGTGACCTGCTTTGGTCTGATCCCTCAGAGGATTATGGCAATGAGAAGACC
NM_001243975.1      GGACCTGTGTGTGACCTGCTTTGGTCTGATCCCTCAGAGGATTATGGCAATGAGAAGACC
                    ************************************************************

HsCD00445142        TTGGAGCACTATACCCACAACACTGTCCGAGGGTGCTCTTATTTCTACAGTTACCCTGCA
NM_001243974.1      TTGGAGCACTATACCCACAACACTGTCCGAGGGTGCTCTTATTTCTACAGTTACCCTGCA
XM_005273564.1      TTGGAGCACTATACCCACAACACTGTCCGAGGGTGCTCTTATTTCTACAGTTACCCTGCA
NM_005605.4         TTGGAGCACTATACCCACAACACTGTCCGAGGGTGCTCTTATTTCTACAGTTACCCTGCA
NM_001243975.1      TTGGAGCACTATACCCACAACACTGTCCGAGGGTGCTCTTATTTCTACAGTTACCCTGCA
                    ************************************************************

HsCD00445142        GTTTGTGAATTTTTGCAGAACAATAATTTACTATCAATTATCAGAGCCCATGAAGCCCAA
NM_001243974.1      GTTTGTGAATTTTTGCAGAACAATAATTTACTATCAATTATCAGAGCCCATGAAGCCCAA
XM_005273564.1      GTTTGTGAATTTTTGCAGAACAATAATTTACTATCAATTATCAGAGCCCATGAAGCCCAA
NM_005605.4         GTTTGTGAATTTTTGCAGAACAATAATTTACTATCAATTATCAGAGCCCATGAAGCCCAA
NM_001243975.1      GTTTGTGAATTTTTGCAGAACAATAATTTACTATCAATTATCAGAGCCCATGAAGCCCAA
                    ************************************************************

HsCD00445142        GATGCTGGGTATCGAATGTACAGGAAGAGCCAAGCCACAGGCTTTCCATCACTTATTACA
NM_001243974.1      GATGCTGGGTATCGAATGTACAGGAAGAGCCAAGCCACAGGCTTTCCATCACTTATTACA
XM_005273564.1      GATGCTGGGTATCGAATGTACAGGAAGAGCCAAGCCACAGGCTTTCCATCACTTATTACA
NM_005605.4         GATGCTGGGTATCGAATGTACAGGAAGAGCCAAGCCACAGGCTTTCCATCACTTATTACA
NM_001243975.1      GATGCTGGGTATCGAATGTACAGGAAGAGCCAAGCCACAGGCTTTCCATCACTTATTACA
                    ************************************************************

HsCD00445142        ATTTTCTCTGCCCCCAATTACCTAGATGTCTATAACAATAAAGCTGCTGTGTTGAAATAT
NM_001243974.1      ATTTTCTCTGCCCCCAATTACCTAGATGTCTATAACAATAAAGCTGCTGTGTTGAAATAT
XM_005273564.1      ATTTTCTCTGCCCCCAATTACCTAGATGTCTATAACAATAAAGCTGCTGTGTTGAAATAT
NM_005605.4         ATTTTCTCTGCCCCCAATTACCTAGATGTCTATAACAATAAAGCTGCTGTGTTGAAATAT
NM_001243975.1      ATTTTCTCTGCCCCCAATTACCTAGATGTCTATAACAATAAAGCTGCTGTGTTGAAATAT
                    ************************************************************

HsCD00445142        GAAAACAATGTCATGAATATCAGGCAGTTTAACTGTTCTCCACACCCCTACTGGCTTCCA
NM_001243974.1      GAAAACAATGTCATGAATATCAGGCAGTTTAACTGTTCTCCACACCCCTACTGGCTTCCA
XM_005273564.1      GAAAACAATGTCATGAATATCAGGCAGTTTAACTGTTCTCCACACCCCTACTGGCTTCCA
NM_005605.4         GAAAACAATGTCATGAATATCAGGCAGTTTAACTGTTCTCCACACCCCTACTGGCTTCCA
NM_001243975.1      GAAAACAATGTCATGAATATCAGGCAGTTTAACTGTTCTCCACACCCCTACTGGCTTCCA
                    ************************************************************

HsCD00445142        AACTTTATGGATGTTTTCACATGGTCTTTGCCTTTTGTTGGGGAAAAAGTCACAGAGATG
NM_001243974.1      AACTTTATGGATGTTTTCACATGGTCTTTGCCTTTTGTTGGGGAAAAAGTCACAGAGATG
XM_005273564.1      AACTTTATGGATGTTTTCACATGGTCTTTGCCTTTTGTTGGGGAAAAAGTCACAGAGATG
NM_005605.4         AACTTTATGGATGTTTTCACATGGTCTTTGCCTTTTGTTGGGGAAAAAGTCACAGAGATG
NM_001243975.1      AACTTTATGGATGTTTTCACATGGTCTTTGCCTTTTGTTGGGGAAAAAGTCACAGAGATG
                    ************************************************************

HsCD00445142        CTGGTAAATGTGCTCAACATATGCTCTGATGACGAACTGATTTCTGATGATGAAGCAGAA
NM_001243974.1      CTGGTAAATGTGCTCAACATATGCTCTGATGACGAACTGATTTCTGATGATGAAGCAGAA
XM_005273564.1      CTGGTAAATGTGCTCAACATATGCTCTGATGACGAACTGATTTCTGATGATGAAGCAGAA
NM_005605.4         CTGGTAAATGTGCTCAACATATGCTCTGATGACGAACTGATTTCTGATGATGAAGCAGAA
NM_001243975.1      CTGGTAAATGTGCTCAACATATGCTCTGATGACGAACTGATTTCTGATGATGAAGCAGAA
                    ************************************************************

HsCD00445142        GG---------------------------AAGCACTACAGTTCGTAAGGAGATCATCAGG
NM_001243974.1      GATCACTACATTCCAAGCTATCAGAAAGGAAGCACTACAGTTCGTAAGGAGATCATCAGG
XM_005273564.1      GATCACTACATTCCAAGCTATCAGAAAGGAAGCACTACAGTTCGTAAGGAGATCATCAGG
NM_005605.4         GG---------------------------AAGCACTACAGTTCGTAAGGAGATCATCAGG
NM_001243975.1      GG---------------------------AAGCACTACAGTTCGTAAGGAGATCATCAGG
                    *.                           *******************************

HsCD00445142        AATAAGATCAGAGCCATTGGGAAGATGGCACGGGTCTTTTCAATTCTTCGGCAAGAAAGT
NM_001243974.1      AATAAGATCAGAGCCATTGGGAAGATGGCACGGGTCTTTTCAATTCTTCGGCAAGAAAGT
XM_005273564.1      AATAAGATCAGAGCCATTGGGAAGATGGCACGGGTCTTTTCAATTCTTCGGCAAGAAAGT
NM_005605.4         AATAAGATCAGAGCCATTGGGAAGATGGCACGGGTCTTTTCAATTCTTCGGCAAGAAAGT
NM_001243975.1      AATAAGATCAGAGCCATTGGGAAGATGGCACGGGTCTTTTCAATTCTTCGGCAAGAAAGT
                    ************************************************************

HsCD00445142        GAGAGTGTGCTGACTCTCAAGGGCCTGACTCCCACAGGCACACTCCCTCTGGGCGTCCTC
NM_001243974.1      GAGAGTGTGCTGACTCTCAAGGGCCTGACTCCCACAGGCACACTCCCTCTGGGCGTCCTC
XM_005273564.1      GAGAGTGTGCTGACTCTCAAGGGCCTGACTCCCACAGGCACACTCCCTCTGGGCGTCCTC
NM_005605.4         GAGAGTGTGCTGACTCTCAAGGGCCTGACTCCCACAGGCACACTCCCTCTGGGCGTCCTC
NM_001243975.1      GAGAGTGTGCTGACTCTCAAGGGCCTGACTCCCACAGGCACACTCCCTCTGGGCGTCCTC
                    ************************************************************

HsCD00445142        TCAGGAGGCAAGCAGACTATCGAGACAGCCACAGTAGAAGCGGTAGAGGCCCGGGAAGCC
NM_001243974.1      TCAGGAGGCAAGCAGACTATCGAGACAGCCACAGTAGAAGCGGTAGAGGCCCGGGAAGCC
XM_005273564.1      TCAGGAGGCAAGCAGACTATCGAGACAGCCATCAGAGGG---------------------
NM_005605.4         TCAGGAGGCAAGCAGACTATCGAGACAGCCACAGTAGAAGCGGTAGAGGCCCGGGAAGCC
NM_001243975.1      TCAGGAGGCAAGCAGACTATCGAGACAGCCATCAGAGGG---------------------
                    ******************************* .. **..                     

HsCD00445142        ATCAGAGGGTTCTCGCTTCAGCACAAGATCCGGAGTTTTGAAGAAGCGCGAGGTCTGGAC
NM_001243974.1      ATCAGAGGGTTCTCGCTTCAGCACAAGATCCGGAGTTTTGAAGAAGCGCGAGGTCTGGAC
XM_005273564.1      ---------TTCTCGCTTCAGCACAAGATCCGGAGTTTTGAAGAAGCGCGAGGTCTGGAC
NM_005605.4         ATCAGAGGGTTCTCGCTTCAGCACAAGATCCGGAGTTTTGAAGAAGCGCGAGGTCTGGAC
NM_001243975.1      ---------TTCTCGCTTCAGCACAAGATCCGGAGTTTTGAAGAAGCGCGAGGTCTGGAC
                             ***************************************************

HsCD00445142        CGAATTAATGAGCGAATGCCACCCCGAAAGGATAGCATACACGCTGGTGGGCCAATGAAA
NM_001243974.1      CGAATTAATGAGCGAATGCCACCCCGAAAGGATAGCATACACGCTGGTGGGCCAATGAAA
XM_005273564.1      CGAATTAATGAGCGAATGCCACCCCGAAAGGATAGCATACACGCTGGTGGGCCAATGAAA
NM_005605.4         CGAATTAATGAGCGAATGCCACCCCGAAAGGATAGCATACACGCTGGTGGGCCAATGAAA
NM_001243975.1      CGAATTAATGAGCGAATGCCACCCCGAAAGGATAGCATACACGCTGGTGGGCCAATGAAA
                    ************************************************************

HsCD00445142        TCTGTAACCTCAGCACACTCACATGCTGCGCACAGGAGCGACCAAGGGAAAAAAGCCCAT
NM_001243974.1      TCTGTAACCTCAGCACACTCACATGCTGCGCACAGGAGCGACCAAGGGAAGAAAGCCCAT
XM_005273564.1      TCTGTAACCTCAGCACACTCACATGCTGCGCACAGGAGCGACCAAGGGAAGAAAGCCCAT
NM_005605.4         TCTGTAACCTCAGCACACTCACATGCTGCGCACAGGAGCGACCAAGGGAAGAAAGCCCAT
NM_001243975.1      TCTGTAACCTCAGCACACTCACATGCTGCGCACAGGAGCGACCAAGGGAAGAAAGCCCAT
                    **************************************************.*********

HsCD00445142        TCA---
NM_001243974.1      TCATGA
XM_005273564.1      TCATGA
NM_005605.4         TCATGA
NM_001243975.1      TCATGA
                    ***   

Pathways

NCI : BCR signaling pathway
Panther : T cell activation
Panther : Wnt signaling pathway
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Apoptosis
Reactome : DARPP-32 events
Reactome : Intrinsic Pathway for Apoptosis
Reactome : Opioid Signalling
Reactome : Signal Transduction
Reactome : Signaling by GPCR
WikiPathway : Alzheimers Disease
WikiPathway : Energy Metabolism
WikiPathway : G Protein Signaling Pathways
WikiPathway : MAPK signaling pathway

Clone

Original Clone ID : ccsbBroad304_06761

Organism


TAX_ID : 9606
Species Specific ID: 5533

Genome

Chromosome : 8
Map Location : 8p21.3
Ensembl : ENSG00000120910

Reagents

Labome : PPP3CC-antibody