DNASU Plasmid Repository • 480.965.5697 | Email

PPIL2 (Homo sapiens) in pLX304 (Gateway V5-tagged lentiviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPIL2
Gene Name:  peptidylprolyl isomerase (cyclophilin)-like 2
Sequence             
Original Clone ID: ccsbBroad304_07930
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLX304               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00445156

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1561nts         Open reading frame : 1 to 1561
Reference Sequence Alignment

ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAACGCTGCCCAC
TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGATAGCCCCGGAGACCAAA
GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
GGCAAGTACATCAACCCAGCAGCCACGAAGCGAGCAGCAGAGGAAGAGCCCTCAACCAGT
GCCACTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLX304

pLX304 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  CMV forward
Reverse:  Unknown
Description: Gateway compatible lentiviral vector with a C-terminal V5 tag and CMV promoter for mammalian cell expression; blasticidin resistance in mammalian cells; ampicillin resistance in bacteria; Gateway cloning.
Comments: None
Size (bp): 9377
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, recombinational cloning, with tag/fusion/marker
Author Name: David Root
Publications: PMID: 21706014
Title: A public genome-scale lentiviral expression library of human ORFs

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
polypurine tract cPPT human immunodeficiency virus type 1 central polypurine tract 3027 3042
promoter T7 T7 promoter 3690 3672
promoter CMV CMV promoter 14 566
recombination site attR1 595 719
recombination site attR2 2282 2297
selectable marker CAT CAT/CamR Chloramphenical resistance 828 1487
selectable marker ccdB Control of cell death B gene 1829 2134
selectable marker AmpR Ampicillin resistance gene 4444 5304
selectable marker BlastR Blasticidin resistance gene 8753 9148
tag V5 C-terminal V5 tag 2301 2342
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 2386 2961

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPIL2
Symbol Nomenclature : PPIL2
SYNONYM : CYC4; CYP60; Cyp-60; UBOX7; hCyP-60
Designation : PPIase|U-box domain containing 7|cyclophilin, 60kDa|cyclophilin-60|cyclophilin-like protein CyP-60|peptidyl-prolyl cis-trans isomerase-like 2|peptidylprolyl cis-trans isomerase|rotamase PPIL2
Full Nomenclature : peptidylprolyl isomerase (cyclophilin)-like 2
GENEID : 23759
GenBank Accession : DQ894846
HGNC : 9261
MIM : 607588
Vega : OTTHUMG00000030174
Target GenBank: DQ894846

 

Reference Sequence Alignment

  

HsCD00445156      ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
NM_148175.2       ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
NM_148176.2       ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
NM_014337.3       ATGGGGAAGCGACAGCACCAAAAGGACAAAATGTACATTACCTGTGCTGAATACACTCAC
                  ************************************************************

HsCD00445156      TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
NM_148175.2       TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
NM_148176.2       TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
NM_014337.3       TTTTATGGTGGCAAGAAGCCAGATCTCCCACAAACAAATTTTCGTCGTTTACCTTTTGAC
                  ************************************************************

HsCD00445156      CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
NM_148175.2       CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
NM_148176.2       CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
NM_014337.3       CACTGCAGTCTCTCTCTGCAGCCCTTTGTCTACCCAGTCTGCACTCCCGATGGCATCGTC
                  ************************************************************

HsCD00445156      TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
NM_148175.2       TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
NM_148176.2       TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
NM_014337.3       TTTGACTTACTGAACATTGTTCCATGGCTTAAGAAGTACGGGACCAACCCCAGCAATGGA
                  ************************************************************

HsCD00445156      GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
NM_148175.2       GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
NM_148176.2       GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
NM_014337.3       GAGAAGCTGGACGGGAGGTCCCTGATCAAGCTGAACTTTTCCAAGAACAGTGAGGGGAAG
                  ************************************************************

HsCD00445156      TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
NM_148175.2       TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
NM_148176.2       TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
NM_014337.3       TACCACTGCCCAGTGCTGTTTACCGTGTTCACCAACAACACCCACATCGTGGCTGTGAGG
                  ************************************************************

HsCD00445156      ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
NM_148175.2       ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
NM_148176.2       ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
NM_014337.3       ACGACCGGCAACGTCTACGCCTATGAGGCAGTGGAACAGCTAAATATCAAGGCCAAGAAC
                  ************************************************************

HsCD00445156      TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
NM_148175.2       TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
NM_148176.2       TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
NM_014337.3       TTCCGGGACCTGCTGACCGACGAGCCCTTCTCCCGGCAGGACATCATCACCCTCCAGGAC
                  ************************************************************

HsCD00445156      CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
NM_148175.2       CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
NM_148176.2       CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
NM_014337.3       CCCACCAATTTGGACAAGTTCAATGTCTCTAACTTCTATCATGTGAAGAATAACATGAAA
                  ************************************************************

HsCD00445156      ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
NM_148175.2       ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
NM_148176.2       ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
NM_014337.3       ATAATAGACCCAGATGAAGAGAAGGCCAAACAGGACCCGTCTTATTATCTGAAAAATACA
                  ************************************************************

HsCD00445156      AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
NM_148175.2       AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
NM_148176.2       AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
NM_014337.3       AATGCCGAGACCCGAGAGACCCTGCAGGAGCTCTACAAGGAGTTCAAAGGGGACGAGATT
                  ************************************************************

HsCD00445156      CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAACGCTGCCCAC
NM_148175.2       CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAACGCTGCCCAC
NM_148176.2       CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAACGCTGCCCAC
NM_014337.3       CTGGCAGCCACCATGAAGGCCCCGGAGAAGAAGAAAGTGGACAAGCTGAACGCTGCCCAC
                  ************************************************************

HsCD00445156      TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
NM_148175.2       TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
NM_148176.2       TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
NM_014337.3       TATTCCACAGGGAAGGTCAGCGCTTCCTTCACCTCCACCGCGATGGTCCCGGAGACCACA
                  ************************************************************

HsCD00445156      CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
NM_148175.2       CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
NM_148176.2       CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
NM_014337.3       CATGAAGCAGCTGCCATCGACGAGGATGTGCTGCGCTACCAGTTTGTGAAGAAGAAGGGC
                  ************************************************************

HsCD00445156      TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
NM_148175.2       TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
NM_148176.2       TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
NM_014337.3       TACGTGCGGCTGCACACCAACAAGGGCGACCTCAACCTGGAGCTGCACTGCGACCTGACA
                  ************************************************************

HsCD00445156      CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
NM_148175.2       CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
NM_148176.2       CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
NM_014337.3       CCAAAAACCTGCGAAAACTTCATCAGGCTTTGCAAGAAGCATTATTACGATGGCACCATC
                  ************************************************************

HsCD00445156      TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
NM_148175.2       TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
NM_148176.2       TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
NM_014337.3       TTCCACAGATCCATCCGGAACTTTGTGATCCAAGGGGGCGACCCCACAGGCACAGGCACG
                  ************************************************************

HsCD00445156      GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
NM_148175.2       GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
NM_148176.2       GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
NM_014337.3       GGTGGGGAGTCATACTGGGGGAAGCCCTTCAAAGACGAGTTCCGGCCCAACCTCTCGCAC
                  ************************************************************

HsCD00445156      ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
NM_148175.2       ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
NM_148176.2       ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
NM_014337.3       ACGGGCCGCGGCATCCTCAGCATGGCCAACTCCGGGCCCAACAGCAACAGGTCTCAATTC
                  ************************************************************

HsCD00445156      TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
NM_148175.2       TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
NM_148176.2       TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
NM_014337.3       TTCATCACGTTTCGCTCCTGTGCCTACCTGGACAAGAAGCATACCATCTTTGGACGGGTT
                  ************************************************************

HsCD00445156      GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
NM_148175.2       GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
NM_148176.2       GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
NM_014337.3       GTTGGGGGCTTTGACGTACTGACAGCCATGGAGAATGTGGAGAGTGACCCCAAAACTGAC
                  ************************************************************

HsCD00445156      CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
NM_148175.2       CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
NM_148176.2       CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
NM_014337.3       CGCCCTAAGGAGGAGATCCGCATTGATGCCACTACAGTGTTCGTGGACCCCTATGAGGAG
                  ************************************************************

HsCD00445156      GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGATAGCCCCGGAGACCAAA
NM_148175.2       GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGGTAGCCCCGGAGACCAAA
NM_148176.2       GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGGTAGCCCCGGAGACCAAA
NM_014337.3       GCCGATGCCCAGATTGCGCAGGAGCGGAAGACACAGCTCAAGGTAGCCCCGGAGACCAAA
                  ******************************************.*****************

HsCD00445156      GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
NM_148175.2       GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
NM_148176.2       GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
NM_014337.3       GTGAAGAGCAGCCAGCCCCAGGCAGGGAGCCAGGGCCCCCAGACCTTCCGCCAGGGCGTG
                  ************************************************************

HsCD00445156      GGCAAGTACATCAACCCAGCAGCCACGAAGCGAGCAGCAGAGGAAGAGCCCTCAACCAGT
NM_148175.2       GGCAAGTACATCAACCCAGCAGCCACGAAGCGAGCAGCAGAGGAAGAGCCCTCAACCAGT
NM_148176.2       GGCAAGTACATCAACCCAGCAGCCACCGAGCAG----CAGAGGAAGAGCCCTCAACCAGT
NM_014337.3       GGCAAGTACATCAACCCAGCAGCCACGAAGCGAGCAGCAGAGGAAGAGCCCTCAACCAGT
                  ************************** .***..    ***********************

HsCD00445156      GCCACTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGG
NM_148175.2       GCCACTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGG
NM_148176.2       GCCACTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGG
NM_014337.3       GCCACTGTCCCCATGTCCAAGAAGAAGCCCAGTCGGGGTTTTGGGGACTTCAGCTCCTGG
                  ************************************************************

HsCD00445156      ----------------------------
NM_148175.2       TAG-------------------------
NM_148176.2       TAGCAGCAGGCTGCCTGATGACCACTAG
NM_014337.3       TAG-------------------------
                                              

Pathways

Reactome : Basigin interactions
Reactome : Cell surface interactions at the vascular wall
Reactome : Hemostasis

Protein

SMART domain : Ubox : Modified RING finger domain
HPRD : 08472

Clone

Original Clone ID : ccsbBroad304_07930

Organism


TAX_ID : 9606
Species Specific ID: 23759

Genome

Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000100023

Reagents

Labome : PPIL2-antibody