DNASU Plasmid Repository • 480.965.5697 | Email

GRB7 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GRB7
Gene Name:  growth factor receptor-bound protein 7
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH015666.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00004471

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1599nts         Open reading frame : 1 to 1599
Reference Sequence Alignment

ATGGAGCTGGATCTGTCTCCACCTCATCTTAGCAGCTCTCCGGAAGACCTTTGCCCAGCC
CCTGGGACCCCTCCTGGGACTCCCCGGCCCCCTGATACCCCTCTGCCTGAGGAGGTAAAG
AGGTCCCAGCCTCTCCTCATCCCAACCACCGGCAGGAAACTTCGAGAGGAGGAGAGGCGT
GCCACCTCCCTCCCCTCTATCCCCAACCCCTTCCCTGAGCTCTGCAGTCCTCCCTCACAG
AGCCCAATTCTCGGGGGCCCCTCCAGTGCAAGGGGGCTGCTCCCCCGCGATGCCAGCCGC
CCCCATGTAGTAAAGGTGTACAGTGAGGATGGGGCCTGCAGGTCTGTGGAGGTGGCAGCA
GGTGCCACAGCTCGCCACGTGTGTGAAATGCTGGTGCAGCGAGCTCACGCCTTGAGCGAC
GAGACCTGGGGGCTGGTGGAGTGCCACCCCCACCTAGCACTGGAGCGGGGTTTGGAGGAC
CACGAGTCCGTGGTGGAAGTGCAGGCTGCCTGGCCCGTGGGCGGAGATAGCCGCTTCGTC
TTCCGGAAAAACTTCGCCAAGTACGAACTGTTCAAGAGCTCCCCACACTCCCTGTTCCCA
GAAAAAATGGTCTCCAGCTGTCTCGATGCACACACTGGTATATCCCATGAAGACCTCATC
CAGAACTTCCTGAATGCTGGCAGCTTTCCTGAGATCCAGGGCTTTCTGCAGCTGCGGGGT
TCAGGACGGAAGCTTTGGAAACGCTTTTTCTGCTTCTTGCGCCGATCTGGCCTCTATTAC
TCCACCAAGGGCACCTCTAAGGATCCGAGGCACCTGCAGTACGTGGCAGATGTGAACGAG
TCCAACGTGTACGTGGTGACGCAGGGCCGCAAGCTCTACGGGATGCCCACTGACTTCGGT
TTCTGTGTCAAGCCCAACAAGCTTCGAAATGGCCACAAGGGGCTTCGGATCTTCTGCAGT
GAAGATGAGCAGAGCCGCACCTGCTGGCTGGCTGCCTTCCGCCTCTTCAAGTACGGGGTG
CAGCTGTACAAGAATTACCAGCAGGCACAGTCTCGCCATCTGCATCCATCTTGTTTGGGC
TCCCCACCCTTGAGAAGTGCCTCAGATAATACCCTGGTGGCCATGGACTTCTCTGGCCAT
GCTGGGCGTGTCATTGAGAACCCCCGGGAGGCTCTGAGTGTGGCCCTGGAGGAGGCCCAG
GCCTGGAGGAAGAAGACAAACCACCGCCTCAGCCTGCCCATGCCAGCCTCCGGCACGAGC
CTCAGTGCAGCCATCCACCGCACCCAACTCTGGTTCCACGGGCGCATTTCCCGTGAGGAG
AGCCAGCGGCTTATTGGACAGCAGGGCTTGGTAGACGGCCTGTTCCTGGTCCGGGAGAGT
CAGCGGAACCCCCAGGGCTTTGTCCTCTCTTTGTGCCACCTGCAGAAAGTGAAGCATTAT
CTCATCCTGCCGAGCGAGGAGGAGGGCCGCCTGTACTTCAGCATGGATGATGGCCAGACC
CGCTTCACTGACCTGCTGCAGCTCGTGGAGTTCCACCAGCTGAACCGCGGCATCCTGCCG
TGCTTGCTGCGCCATTGCTGCACGCGGGTGGCCCTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1714
Start on reference sequence 116
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GRB7
Symbol Nomenclature : GRB7
Designation : B47|GRB7 adapter protein|epidermal growth factor receptor GRB-7
Full Nomenclature : growth factor receptor-bound protein 7
GENEID : 2886
GI : 61361802
GenBank Accession : AY890163
HGNC : 4567
MIM : 601522
Vega : OTTHUMG00000133253
Target GenBank: BC006535

 

Reference Sequence Alignment

  

HsCD00004471        ------------------------------------------------------------
NM_001030002.2      ------------------------------------------------------------
NM_001242443.1      ------------------------------------------------------------
NM_001242442.1      ATGGGAAAGTGGAGGCCGGGACAAGGGCACACAACTGGTTCCGTTAAGCCCCTCTCTCGC
NM_005310.3         ------------------------------------------------------------
                                                                                

HsCD00004471        ---------ATGGAGCTGGATCTGTCTCCACCTCATCTTAGCAGCTCTCCGGAAGACCTT
NM_001030002.2      ---------ATGGAGCTGGATCTGTCTCCACCTCATCTTAGCAGCTCTCCGGAAGACCTT
NM_001242443.1      ---------ATGGAGCTGGATCTGTCTCCACCTCATCTTAGCAGCTCTCCGGAAGACCTT
NM_001242442.1      TCAGACGCCATGGAGCTGGATCTGTCTCCACCTCATCTTAGCAGCTCTCCGGAAGACCTT
NM_005310.3         ---------ATGGAGCTGGATCTGTCTCCACCTCATCTTAGCAGCTCTCCGGAAGACCTT
                             ***************************************************

HsCD00004471        TGCCCAGCCCCTGGGACCCCTCCTGGGACTCCCCGGCCCCCTGATACCCCTCTGCCTGAG
NM_001030002.2      TGCCCAGCCCCTGGGACCCCTCCTGGGACTCCCCGGCCCCCTGATACCCCTCTGCCTGAG
NM_001242443.1      TGCCCAGCCCCTGGGACCCCTCCTGGGACTCCCCGGCCCCCTGATACCCCTCTGCCTGAG
NM_001242442.1      TGCCCAGCCCCTGGGACCCCTCCTGGGACTCCCCGGCCCCCTGATACCCCTCTGCCTGAG
NM_005310.3         TGCCCAGCCCCTGGGACCCCTCCTGGGACTCCCCGGCCCCCTGATACCCCTCTGCCTGAG
                    ************************************************************

HsCD00004471        GAGGTAAAGAGGTCCCAGCCTCTCCTCATCCCAACCACCGGCAGGAAACTTCGAGAGGAG
NM_001030002.2      GAGGTAAAGAGGTCCCAGCCTCTCCTCATCCCAACCACCGGCAGGAAACTTCGAGAGGAG
NM_001242443.1      GAGGTAAAGAGGTCCCAGCCTCTCCTCATCCCAACCACCGGCAGGAAACTTCGAGAGGAG
NM_001242442.1      GAGGTAAAGAGGTCCCAGCCTCTCCTCATCCCAACCACCGGCAGGAAACTTCGAGAGGAG
NM_005310.3         GAGGTAAAGAGGTCCCAGCCTCTCCTCATCCCAACCACCGGCAGGAAACTTCGAGAGGAG
                    ************************************************************

HsCD00004471        GAGAGGCGTGCCACCTCCCTCCCCTCTATCCCCAACCCCTTCCCTGAGCTCTGCAGTCCT
NM_001030002.2      GAGAGGCGTGCCACCTCCCTCCCCTCTATCCCCAACCCCTTCCCTGAGCTCTGCAGTCCT
NM_001242443.1      GAGAGGCGTGCCACCTCCCTCCCCTCTATCCCCAACCCCTTCCCTGAGCTCTGCAGTCCT
NM_001242442.1      GAGAGGCGTGCCACCTCCCTCCCCTCTATCCCCAACCCCTTCCCTGAGCTCTGCAGTCCT
NM_005310.3         GAGAGGCGTGCCACCTCCCTCCCCTCTATCCCCAACCCCTTCCCTGAGCTCTGCAGTCCT
                    ************************************************************

HsCD00004471        CCCTCACAGAGCCCAATTCTCGGGGGCCCCTCCAGTGCAAGGGGGCTGCTCCCCCGCGAT
NM_001030002.2      CCCTCACAGAGCCCAATTCTCGGGGGCCCCTCCAGTGCAAGGGGGCTGCTCCCCCGCGAT
NM_001242443.1      CCCTCACAGAGCCCAATTCTCGGGGGCCCCTCCAGTGCAAGGGGGCTGCTCCCCCGCGAT
NM_001242442.1      CCCTCACAGAGCCCAATTCTCGGGGGCCCCTCCAGTGCAAGGGGGCTGCTCCCCCGCGAT
NM_005310.3         CCCTCACAGAGCCCAATTCTCGGGGGCCCCTCCAGTGCAAGGGGGCTGCTCCCCCGCGAT
                    ************************************************************

HsCD00004471        GCCAGCCGCCCCCATGTAGTAAAGGTGTACAGTGAGGATGGGGCCTGCAGGTCTGTGGAG
NM_001030002.2      GCCAGCCGCCCCCATGTAGTAAAGGTGTACAGTGAGGATGGGGCCTGCAGGTCTGTGGAG
NM_001242443.1      GCCAGCCGCCCCCATGTAGTAAAGGTGTACAGTGAGGATGGGGCCTGCAGGTCTGTGGAG
NM_001242442.1      GCCAGCCGCCCCCATGTAGTAAAGGTGTACAGTGAGGATGGGGCCTGCAGGTCTGTGGAG
NM_005310.3         GCCAGCCGCCCCCATGTAGTAAAGGTGTACAGTGAGGATGGGGCCTGCAGGTCTGTGGAG
                    ************************************************************

HsCD00004471        GTGGCAGCAGGTGCCACAGCTCGCCACGTGTGTGAAATGCTGGTGCAGCGAGCTCACGCC
NM_001030002.2      GTGGCAGCAGGTGCCACAGCTCGCCACGTGTGTGAAATGCTGGTGCAGCGAGCTCACGCC
NM_001242443.1      GTGGCAGCAGGTGCCACAGCTCGCCACGTGTGTGAAATGCTGGTGCAGCGAGCTCACGCC
NM_001242442.1      GTGGCAGCAGGTGCCACAGCTCGCCACGTGTGTGAAATGCTGGTGCAGCGAGCTCACGCC
NM_005310.3         GTGGCAGCAGGTGCCACAGCTCGCCACGTGTGTGAAATGCTGGTGCAGCGAGCTCACGCC
                    ************************************************************

HsCD00004471        TTGAGCGACGAGACCTGGGGGCTGGTGGAGTGCCACCCCCACCTAGCACTGGAGCGGGGT
NM_001030002.2      TTGAGCGACGAGACCTGGGGGCTGGTGGAGTGCCACCCCCACCTAGCACTGGAGCGGGGT
NM_001242443.1      TTGAGCGACGAGACCTGGGGGCTGGTGGAGTGCCACCCCCACCTAGCACTGGAGCGGGGT
NM_001242442.1      TTGAGCGACGAGACCTGGGGGCTGGTGGAGTGCCACCCCCACCTAGCACTGGAGCGGGGT
NM_005310.3         TTGAGCGACGAGACCTGGGGGCTGGTGGAGTGCCACCCCCACCTAGCACTGGAGCGGGGT
                    ************************************************************

HsCD00004471        TTGGAGGACCACGAGTCCGTGGTGGAAGTGCAGGCTGCCTGGCCCGTGGGCGGAGATAGC
NM_001030002.2      TTGGAGGACCACGAGTCCGTGGTGGAAGTGCAGGCTGCCTGGCCCGTGGGCGGAGATAGC
NM_001242443.1      TTGGAGGACCACGAGTCCGTGGTGGAAGTGCAGGCTGCCTGGCCCGTGGGCGGAGATAGC
NM_001242442.1      TTGGAGGACCACGAGTCCGTGGTGGAAGTGCAGGCTGCCTGGCCCGTGGGCGGAGATAGC
NM_005310.3         TTGGAGGACCACGAGTCCGTGGTGGAAGTGCAGGCTGCCTGGCCCGTGGGCGGAGATAGC
                    ************************************************************

HsCD00004471        CGCTTCGTCTTCCGGAAAAACTTCGCCAAGTACGAACTGTTCAAGAGCTCCCCACACTCC
NM_001030002.2      CGCTTCGTCTTCCGGAAAAACTTCGCCAAGTACGAACTGTTCAAGAGCTCCCCACACTCC
NM_001242443.1      CGCTTCGTCTTCCGGAAAAACTTCGCCAAGTACGAACTGTTCAAGAGCTCCCCACACTCC
NM_001242442.1      CGCTTCGTCTTCCGGAAAAACTTCGCCAAGTACGAACTGTTCAAGAGCTCCCCACACTCC
NM_005310.3         CGCTTCGTCTTCCGGAAAAACTTCGCCAAGTACGAACTGTTCAAGAGCTCCCCACACTCC
                    ************************************************************

HsCD00004471        CTGTTCCCAGAAAAAATGGTCTCCAGCTGTCTCGATGCACACACTGGTATATCCCATGAA
NM_001030002.2      CTGTTCCCAGAAAAAATGGTCTCCAGCTGTCTCGATGCACACACTGGTATATCCCATGAA
NM_001242443.1      CTGTTCCCAGAAAAAATGGTCTCCAGCTGTCTCGATGCACACACTGGTATATCCCATGAA
NM_001242442.1      CTGTTCCCAGAAAAAATGGTCTCCAGCTGTCTCGATGCACACACTGGTATATCCCATGAA
NM_005310.3         CTGTTCCCAGAAAAAATGGTCTCCAGCTGTCTCGATGCACACACTGGTATATCCCATGAA
                    ************************************************************

HsCD00004471        GACCTCATCCAGAACTTCCTGAATGCTGGCAGCTTTCCTGAGATCCAGGGCTTTCTGCAG
NM_001030002.2      GACCTCATCCAGAACTTCCTGAATGCTGGCAGCTTTCCTGAGATCCAGGGCTTTCTGCAG
NM_001242443.1      GACCTCATCCAGAACTTCCTGAATGCTGGCAGCTTTCCTGAGATCCAGGGCTTTCTGCAG
NM_001242442.1      GACCTCATCCAGAACTTCCTGAATGCTGGCAGCTTTCCTGAGATCCAGGGCTTTCTGCAG
NM_005310.3         GACCTCATCCAGAACTTCCTGAATGCTGGCAGCTTTCCTGAGATCCAGGGCTTTCTGCAG
                    ************************************************************

HsCD00004471        CTGCGGGGTTCAGGACGGAAGCTTTGGAAACGCTTTTTCTGCTTCTTGCGCCGATCTGGC
NM_001030002.2      CTGCGGGGTTCAGGACGGAAGCTTTGGAAACGCTTTTTCTGCTTCTTGCGCCGATCTGGC
NM_001242443.1      CTGCGGGGTTCAGGACGGAAGCTTTGGAAACGCTTTTTCTGCTTCTTGCGCCGATCTGGC
NM_001242442.1      CTGCGGGGTTCAGGACGGAAGCTTTGGAAACGCTTTTTCTGCTTCTTGCGCCGATCTGGC
NM_005310.3         CTGCGGGGTTCAGGACGGAAGCTTTGGAAACGCTTTTTCTGCTTCTTGCGCCGATCTGGC
                    ************************************************************

HsCD00004471        CTCTATTACTCCACCAAGGGCACCTCTAAGGATCCGAGGCACCTGCAGTACGTGGCAGAT
NM_001030002.2      CTCTATTACTCCACCAAGGGCACCTCTAAGGATCCGAGGCACCTGCAGTACGTGGCAGAT
NM_001242443.1      CTCTATTACTCCACCAAGGGCACCTCTAAGGATCCGAGGCACCTGCAGTACGTGGCAGAT
NM_001242442.1      CTCTATTACTCCACCAAGGGCACCTCTAAGGATCCGAGGCACCTGCAGTACGTGGCAGAT
NM_005310.3         CTCTATTACTCCACCAAGGGCACCTCTAAGGATCCGAGGCACCTGCAGTACGTGGCAGAT
                    ************************************************************

HsCD00004471        GTGAACGAGTCCAACGTGTACGTGGTGACGCAGGGCCGCAAGCTCTACGGGATGCCCACT
NM_001030002.2      GTGAACGAGTCCAACGTGTACGTGGTGACGCAGGGCCGCAAGCTCTACGGGATGCCCACT
NM_001242443.1      GTGAACGAGTCCAACGTGTACGTGGTGACGCAGGGCCGCAAGCTCTACGGGATGCCCACT
NM_001242442.1      GTGAACGAGTCCAACGTGTACGTGGTGACGCAGGGCCGCAAGCTCTACGGGATGCCCACT
NM_005310.3         GTGAACGAGTCCAACGTGTACGTGGTGACGCAGGGCCGCAAGCTCTACGGGATGCCCACT
                    ************************************************************

HsCD00004471        GACTTCGGTTTCTGTGTCAAGCCCAACAAGCTTCGAAATGGCCACAAGGGGCTTCGGATC
NM_001030002.2      GACTTCGGTTTCTGTGTCAAGCCCAACAAGCTTCGAAATGGCCACAAGGGGCTTCGGATC
NM_001242443.1      GACTTCGGTTTCTGTGTCAAGCCCAACAAGCTTCGAAATGGCCACAAGGGGCTTCGGATC
NM_001242442.1      GACTTCGGTTTCTGTGTCAAGCCCAACAAGCTTCGAAATGGCCACAAGGGGCTTCGGATC
NM_005310.3         GACTTCGGTTTCTGTGTCAAGCCCAACAAGCTTCGAAATGGCCACAAGGGGCTTCGGATC
                    ************************************************************

HsCD00004471        TTCTGCAGTGAAGATGAGCAGAGCCGCACCTGCTGGCTGGCTGCCTTCCGCCTCTTCAAG
NM_001030002.2      TTCTGCAGTGAAGATGAGCAGAGCCGCACCTGCTGGCTGGCTGCCTTCCGCCTCTTCAAG
NM_001242443.1      TTCTGCAGTGAAGATGAGCAGAGCCGCACCTGCTGGCTGGCTGCCTTCCGCCTCTTCAAG
NM_001242442.1      TTCTGCAGTGAAGATGAGCAGAGCCGCACCTGCTGGCTGGCTGCCTTCCGCCTCTTCAAG
NM_005310.3         TTCTGCAGTGAAGATGAGCAGAGCCGCACCTGCTGGCTGGCTGCCTTCCGCCTCTTCAAG
                    ************************************************************

HsCD00004471        TACGGGGTGCAGCTGTACAAGAATTACCAGCAGGCACAGTCTCGCCATCTGCATCCATCT
NM_001030002.2      TACGGGGTGCAGCTGTACAAGAATTACCAGCAGGCACAGTCTCGCCATCTGCATCCATCT
NM_001242443.1      TACGGGGTGCAGCTGTACAAGAATTACCAGCAGGCACAGTCTCGCCATCTGCATCCATCT
NM_001242442.1      TACGGGGTGCAGCTGTACAAGAATTACCAGCAGGCACAGTCTCGCCATCTGCATCCATCT
NM_005310.3         TACGGGGTGCAGCTGTACAAGAATTACCAGCAGGCACAGTCTCGCCATCTGCATCCATCT
                    ************************************************************

HsCD00004471        TGTTTGGGCTCCCCACCCTTGAGAAGTGCCTCAGATAATACCCTGGTGGCCATGGACTTC
NM_001030002.2      TGTTTGGGCTCCCCACCCTTGAGAAGTGCCTCAGATAATACCCTGGTGGCCATGGACTTC
NM_001242443.1      TGTTTGGGCTCCCCACCCTTGAGAAGTGCCTCAGATAATACCCTGGTGGCCATGGACTTC
NM_001242442.1      TGTTTGGGCTCCCCACCCTTGAGAAGTGCCTCAGATAATACCCTGGTGGCCATGGACTTC
NM_005310.3         TGTTTGGGCTCCCCACCCTTGAGAAGTGCCTCAGATAATACCCTGGTGGCCATGGACTTC
                    ************************************************************

HsCD00004471        TCTGGCCATGCTGGGCGTGTCATTGAGAACCCCCGGGAGGCTCTGAGTGTGGCCCTGGAG
NM_001030002.2      TCTGGCCATGCTGGGCGTGTCATTGAGAACCCCCGGGAGGCTCTGAGTGTGGCCCTGGAG
NM_001242443.1      TCTGGCCATGCTGGGCGTGTCATTGAGAACCCCCGGGAGGCTCTGAGTGTGGCCCTGGAG
NM_001242442.1      TCTGGCCATGCTGGGCGTGTCATTGAGAACCCCCGGGAGGCTCTGAGTGTGGCCCTGGAG
NM_005310.3         TCTGGCCATGCTGGGCGTGTCATTGAGAACCCCCGGGAGGCTCTGAGTGTGGCCCTGGAG
                    ************************************************************

HsCD00004471        GAGGCCCAGGCCTGGAGGAAGAAGACAAACCACCGCCTCAGCCTGCCCATGCCAGCCTCC
NM_001030002.2      GAGGCCCAGGCCTGGAGGAAGAAGACAAACCACCGCCTCAGCCTGCCCATGCCAGCCTCC
NM_001242443.1      GAGGCCCAGGCCTGGAGGAAGAAGACAAACCACCGCCTCAGCCTGCCCATGCCAGCCTCC
NM_001242442.1      GAGGCCCAGGCCTGGAGGAAGAAGACAAACCACCGCCTCAGCCTGCCCATGCCAGCCTCC
NM_005310.3         GAGGCCCAGGCCTGGAGGAAGAAGACAAACCACCGCCTCAGCCTGCCCATGCCAGCCTCC
                    ************************************************************

HsCD00004471        GGCACGAGCCTCAGTGCAGCCATCCACCGCACCCAACTCTGGTTCCACGGGCGCATTTCC
NM_001030002.2      GGCACGAGCCTCAGTGCAGCCATCCACCGCACCCAACTCTGGTTCCACGGGCGCATTTCC
NM_001242443.1      GGCACGAGCCTCAGTGCAGCCATCCACCGCACCCAACTCTGGTTCCACGGGCGCATTTCC
NM_001242442.1      GGCACGAGCCTCAGTGCAGCCATCCACCGCACCCAACTCTGGTTCCACGGGCGCATTTCC
NM_005310.3         GGCACGAGCCTCAGTGCAGCCATCCACCGCACCCAACTCTGGTTCCACGGGCGCATTTCC
                    ************************************************************

HsCD00004471        CGTGAGGAGAGCCAGCGGCTTATTGGACAGCAGGGCTTGGTAGACGGCCTGTTCCTGGTC
NM_001030002.2      CGTGAGGAGAGCCAGCGGCTTATTGGACAGCAGGGCTTGGTAGACGGCCTGTTCCTGGTC
NM_001242443.1      CGTGAGGAGAGCCAGCGGCTTATTGGACAGCAGGGCTTGGTAGACGGCCTGTTCCTGGTC
NM_001242442.1      CGTGAGGAGAGCCAGCGGCTTATTGGACAGCAGGGCTTGGTAGACGGCCTGTTCCTGGTC
NM_005310.3         CGTGAGGAGAGCCAGCGGCTTATTGGACAGCAGGGCTTGGTAGACGGCCTGTTCCTGGTC
                    ************************************************************

HsCD00004471        CGGGAGAGTCAGCGGAACCCCCAGGGCTTTGTCCTCTCTTTGTGCCACCTGCAGAAAGTG
NM_001030002.2      CGGGAGAGTCAGCGGAACCCCCAGGGCTTTGTCCTCTCTTTGTGCCACCTGCAGAAAGTG
NM_001242443.1      CGGGAGAGTCAGCGGAACCCCCAGGGCTTTGTCCTCTCTTTGTGCCACCTGCAGAAAGTG
NM_001242442.1      CGGGAGAGTCAGCGGAACCCCCAGGGCTTTGTCCTCTCTTTGTGCCACCTGCAGAAAGTG
NM_005310.3         CGGGAGAGTCAGCGGAACCCCCAGGGCTTTGTCCTCTCTTTGTGCCACCTGCAGAAAGTG
                    ************************************************************

HsCD00004471        AAGCATTATCTCATCCTGCCGAGCGAGGAGGAGGGCCGCCTGTACTTCAGCATGGATGAT
NM_001030002.2      AAGCATTATCTCATCCTGCCGAGCGAGGAGGAGGGCCGCCTGTACTTCAGCATGGATGAT
NM_001242443.1      AAGCATTATCTCATCCTGCCGAGCGAGGAGGAGGGCCGCCTGTACTTCAGCATGGATGAT
NM_001242442.1      AAGCATTATCTCATCCTGCCGAGCGAGGAGGAGGGCCGCCTGTACTTCAGCATGGATGAT
NM_005310.3         AAGCATTATCTCATCCTGCCGAGCGAGGAGGAGGGCCGCCTGTACTTCAGCATGGATGAT
                    ************************************************************

HsCD00004471        GGCCAGACCCGCTTCACTGACCTGCTGCAGCTCGTGGAGTTCCACCAGCTGAACCGCGGC
NM_001030002.2      GGCCAGACCCGCTTCACTGACCTGCTGCAGCTCGTGGAGTTCCACCAGCTGAACCGCGGC
NM_001242443.1      GGCCAGACCCGCTTCACTGACCTGCTGCAGCTCGTGGAGTTCCACCAGCTGAACCGCGGC
NM_001242442.1      GGCCAGACCCGCTTCACTGACCTGCTGCAGCTCGTGGAGTTCCACCAGCTGAACCGCGGC
NM_005310.3         GGCCAGACCCGCTTCACTGACCTGCTGCAGCTCGTGGAGTTCCACCAGCTGAACCGCGGC
                    ************************************************************

HsCD00004471        ATCCTGCCGTGCTTGCTGCGCCATTGCTGCACGCGGGTGGCCCTCTAG
NM_001030002.2      ATCCTGCCGTGCTTGCTGCGCCATTGCTGCACGCGGGTGGCCCTCTGA
NM_001242443.1      ATCCTGCCGTGCTTGCTGCGCCATTGCTGCACGCGGGTGGCCCTCTGA
NM_001242442.1      ATCCTGCCGTGCTTGCTGCGCCATTGCTGCACGCGGGTGGCCCTCTGA
NM_005310.3         ATCCTGCCGTGCTTGCTGCGCCATTGCTGCACGCGGGTGGCCCTCTGA
                    **********************************************..

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : EPHB forward signaling
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events regulated by Ret tyrosine kinase
Panther : Angiogenesis
Reactome : Cell surface interactions at the vascular wall
Reactome : Downstream signal transduction
Reactome : GRB7 events in ERBB2 signaling
Reactome : Hemostasis
Reactome : Signal Transduction
Reactome : Signaling by ERBB2
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Tie2 Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : angiogenesis overview

Protein

SMART domain : PH : Pleckstrin homology domain.
SMART domain : RA : Ras association (RalGDS/AF-6) domain
SMART domain : SH2 : Src homology 2 domains
UniProt : Q14451
UniProt : Q53YD3
HPRD : 03311

Clone

Cloning Information : 15666
HIP Master Clone ID : 29865
Original Clone ID : FLH015666.01X

Organism


TAX_ID : 9606
Species Specific ID: 2886

Genome

Chromosome : 17
Map Location : 17q12
Ensembl : ENSG00000141738

Reagents

Labome : GRB7-antibody