DNASU Plasmid Repository • 480.965.5697 | Email

POLR2L (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POLR2L
Gene Name:  polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH029330.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004472

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 204nts         Open reading frame : 1 to 204
Reference Sequence Alignment

ATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGATCGTCGGCAACAAGTGGGAGGCT
TACCTGGGGCTGCTGCAGGCCGAGTACACCGAGGGGGACGCGCTGGATGCCCTGGGCCTG
AAGCGCTACTGCTGCCGCCGGATGCTGCTGGCCCACGTGGACCTGATCGAGAAGCTGCTC
AATTATGCACCCCTGGAGAAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 215
Start on reference sequence 12
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POLR2L
Symbol Nomenclature : POLR2L
SYNONYM : RBP10; RPABC5; RPB10; RPB10beta; RPB7.6; hRPB7.6
Designation : DNA-directed RNA polymerase III subunit L|DNA-directed RNA polymerases I, II, and III subunit RPABC5|RNA polymerase II 7.6 kDa subunit|RNA polymerases I, II, and III subunit ABC5|RPB10 homolog
Full Nomenclature : polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
GENEID : 5441
GI : 60653740
GenBank Accession : AY892647
HGNC : 9199
MIM : 601189
Vega : OTTHUMG00000133316
Target GenBank: BC018649

 

Reference Sequence Alignment

  

HsCD00004472      ATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGATCGTCGGCAACAAGTGGGAGGCT
NM_021128.4       ATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGATCGTCGGCAACAAGTGGGAGGCT
                  ************************************************************

HsCD00004472      TACCTGGGGCTGCTGCAGGCCGAGTACACCGAGGGGGACGCGCTGGATGCCCTGGGCCTG
NM_021128.4       TACCTGGGGCTGCTGCAGGCCGAGTACACCGAGGGGGATGCGCTGGATGCCCTGGGCCTG
                  ************************************** *********************

HsCD00004472      AAGCGCTACTGCTGCCGCCGGATGCTGCTGGCCCACGTGGACCTGATCGAGAAGCTGCTC
NM_021128.4       AAGCGCTACTGCTGCCGCCGGATGCTGCTGGCCCACGTGGACCTGATCGAGAAGCTGCTC
                  ************************************************************

HsCD00004472      AATTATGCACCCCTGGAGAAGTTG
NM_021128.4       AATTATGCACCCCTGGAGAAGTGA
                  ********************** .

Pathways

Panther : Transcription regulation by bZIP transcription factor
Reactome : Abortive elongation of HIV-1 transcript in the absence of Tat
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Repair
Reactome : Disease
Reactome : Dual incision reaction in TC-NER
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV Transcription Initiation
Reactome : HIV elongation arrest and recovery
Reactome : Immune System
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Influenza Viral RNA Transcription and Replication
Reactome : Innate Immune System
Reactome : Late Phase of HIV Life Cycle
Reactome : MicroRNA (miRNA) biogenesis
Reactome : Nucleotide Excision Repair
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : RNA Pol II CTD phosphorylation and interaction with CE
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase II HIV Promoter Escape
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Promoter Escape
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Initiation
Reactome : RNA Polymerase II Transcription Initiation And Promoter Clearance
Reactome : RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
Reactome : RNA Polymerase III Abortive And Retractive Initiation
Reactome : RNA Polymerase III Chain Elongation
Reactome : RNA Polymerase III Transcription
Reactome : RNA Polymerase III Transcription Initiation
Reactome : RNA Polymerase III Transcription Initiation From Type 1 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 2 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 3 Promoter
Reactome : RNA Polymerase III Transcription Termination
Reactome : Regulatory RNA pathways
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)
Reactome : Viral Messenger RNA Synthesis
Reactome : mRNA Capping
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
Reactome : mRNA Splicing - Minor Pathway

Protein

UniProt : P62875
HPRD : 01155

Clone

Cloning Information : 29330
HIP Master Clone ID : 59706
Original Clone ID : FLH029330.01L

Organism


TAX_ID : 9606
Species Specific ID: 5441

Genome

Chromosome : 11
Map Location : 11p15
Ensembl : ENSG00000177700

Reagents

Labome : POLR2L-antibody