DNASU Plasmid Repository • 480.965.5697 | Email

HLA-A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HLA-A
Gene Name:  major histocompatibility complex, class I, A
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH024925.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00004475

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1098nts        
Open reading frame : 1 to 1098
Reference Sequence Alignment

ATGGCCGTCATGGCGCCCCGAACCCTCGTCCTGCTACTCTCGGGGGCTCTGGCCCTGACC
CAGACCTGGGCGGGCTCTCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGC
CGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTC
GACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGT
CCGGAGTATTGGGACGGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTG
GACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGTTCTCACACCGTCCAG
AGGATGTATGGCTGCGACGTGGGGTCGGACTGGCGCTTCCTCCGCGGGTACCACCAGTAC
GCCTACGACGGCAAGGATTACATCGCCCTGAAAGAGGACCTGCGCCCTTGGACCGCGGCG
GACATGGCAGCTCAGACCACCAAGCACAAGTGGGAGGCGGCCCATGTGGCGGAGCAGTTG
AGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAG
GAGACGCTGCAGCGCACGGACGCCCCCAAAACGCATATGACTCACCACGCTGTCTCTGAC
CATGAAGCCACCCTGAGGTGCTGGGCCCTGAGCTTCTACCCTGCGGAGATCACACTGACC
TGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCA
GGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGACAGGAGCAGAGA
TACACCTGCCATGTGCAGCATGAGGGTTTGCCCAAGCCCCTCACCCTGAGATGGGAGCCG
TCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCTTTGGAGCT
GTGATCACTGGAGCTGTGGTCGCTGCTGTGATGTGGAGGAGGAAGAGCTCAGATAGAAAA
GGAGGGAGCTACTCTCAGGCTGCAAGCAGTGACAGTGCCCAGGGCTCTGATGTGTCTCTC
ACAGCTTGTAAAGTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1112
Start on reference sequence 15
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HLA-A
Symbol Nomenclature : HLA-A
SYNONYM : HLAA
Designation : HLA class I histocompatibility antigen, A-1 alpha chain|MHC class I antigen HLA-A heavy chain|antigen presenting molecule|leukocyte antigen class I-A
Full Nomenclature : major histocompatibility complex, class I, A
GENEID : 3105
Locus Tag : DAQB-90C11.16-002
GI : 60653742
GenBank Accession : AY892648
HGNC : 4931
MIM : 142800
Vega : OTTHUMG00000130501
Target GenBank: BC019236

 

Reference Sequence Alignment

  

HsCD00004475        ATGGCCGTCATGGCGCCCCGAACCCTCGTCCTGCTACTCTCGGGGGCTCTGGCCCTGACC
XM_005275331.1      ---------ATGGCGCCCCGAACCCTCGTCCTGCTACTCTCGGGGGCTCTGGCCCTGACC
NM_001242758.1      ATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACC
NM_002116.7         ATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACC
                             ****************** ******************* ************

HsCD00004475        CAGACCTGGGCGGGCTCTCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGC
XM_005275331.1      CAGACCTGGGCGGGCTCTCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGC
NM_001242758.1      CAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGC
NM_002116.7         CAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGC
                    ***************** ******************************************

HsCD00004475        CGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTC
XM_005275331.1      CGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTC
NM_001242758.1      CGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTC
NM_002116.7         CGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTC
                    ***********************.************************************

HsCD00004475        GACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGT
XM_005275331.1      GACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGT
NM_001242758.1      GACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGG
NM_002116.7         GACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGG
                    **********************.************************************ 

HsCD00004475        CCGGAGTATTGGGACGGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTG
XM_005275331.1      CCGGAGTATTGGGACGGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTG
NM_001242758.1      CCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCACTCACAGACTGACCGAGCG
NM_002116.7         CCGGAGTATTGGGACCAGGAGACACGGAATGTGAAGGCCCAGTCACAGACTGACCGAGTG
                    *************** .************:.********** ********* ****** *

HsCD00004475        GACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGTTCTCACACCGTCCAG
XM_005275331.1      GACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGTTCTCACACCGTCCAG
NM_001242758.1      AACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCACACCATCCAG
NM_002116.7         GACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGTTCTCACACCATCCAG
                    .***************************************.*************.*****

HsCD00004475        AGGATGTATGGCTGCGACGTGGGGTCGGACTGGCGCTTCCTCCGCGGGTACCACCAGTAC
XM_005275331.1      AGGATGTATGGCTGCGACGTGGGGTCGGACTGGCGCTTCCTCCGCGGGTACCACCAGTAC
NM_001242758.1      ATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGAC
NM_002116.7         ATAATGTATGGCTGCGACGTGGGGTCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGAC
                    * .********************* ***** *********************. *** **

HsCD00004475        GCCTACGACGGCAAGGATTACATCGCCCTGAAAGAGGACCTGCGCCCTTGGACCGCGGCG
XM_005275331.1      GCCTACGACGGCAAGGATTACATCGCCCTGAAAGAGGACCTGCGCTCTTGGACCGCGGCG
NM_001242758.1      GCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCG
NM_002116.7         GCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCG
                    ********************************.************ **************

HsCD00004475        GACATGGCAGCTCAGACCACCAAGCACAAGTGGGAGGCGGCCCATGTGGCGGAGCAGTTG
XM_005275331.1      GACATGGCAGCTCAGACCACCAAGCACAAGTGGGAGGCGGCCCATGTGGCGGAGCAGTTG
NM_001242758.1      GACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGG
NM_002116.7         GACATGGCGGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCATGAGGCGGAGCAGTTG
                    ********.******* ********.************** ***** **********  *

HsCD00004475        AGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAG
XM_005275331.1      AGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAG
NM_001242758.1      AGAGTCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAG
NM_002116.7         AGAGCCTACCTGGATGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAG
                    **** ********* ***. *********  *****************************

HsCD00004475        GAGACGCTGCAGCGCACGGACGCCCCCAAAACGCATATGACTCACCACGCTGTCTCTGAC
XM_005275331.1      GAGACGCTGCAGCGCACGGACGCCCCCAAAACGCATATGACTCACCACGCTGTCTCTGAC
NM_001242758.1      GAGACGCTGCAGCGCACGGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGAC
NM_002116.7         GAGACGCTGCAGCGCACGGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGAC
                    ********************* *******.**.******** ****** * .********

HsCD00004475        CATGAAGCCACCCTGAGGTGCTGGGCCCTGAGCTTCTACCCTGCGGAGATCACACTGACC
XM_005275331.1      CATGAAGCCACCCTGAGGTGCTGGGCCCTGAGCTTCTACCCTGCGGAGATCACACTGACC
NM_001242758.1      CATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
NM_002116.7         CATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
                    *****.************************.*****************************

HsCD00004475        TGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCA
XM_005275331.1      TGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCA
NM_001242758.1      TGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCA
NM_002116.7         TGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCA
                    ************************************************************

HsCD00004475        GGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGACAGGAGCAGAGA
XM_005275331.1      GGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGACAGGAGCAGAGA
NM_001242758.1      GGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGA
NM_002116.7         GGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGA
                    ************************************************ ***********

HsCD00004475        TACACCTGCCATGTGCAGCATGAGGGTTTGCCCAAGCCCCTCACCCTGAGATGGGAGCCG
XM_005275331.1      TACACCTGCCATGTGCAGCATGAGGGTTTGCCCAAGCCCCTCACCCTGAGATGGGAGCCG
NM_001242758.1      TACACCTGCCATGTGCAGCATGAGGGTCTGCCCAAGCCCCTCACCCTGAGATGGGAGCTG
NM_002116.7         TACACCTGCCATGTGCAGCATGAGGGTCTGCCCAAGCCCCTCACCCTGAGATGGGAGCTG
                    *************************** ****************************** *

HsCD00004475        TCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCTTTGGAGCT
XM_005275331.1      TCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCTTTGGAGCT
NM_001242758.1      TCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGAGCT
NM_002116.7         TCTTCCCAGCCCACCATCCCCATCGTGGGCATCATTGCTGGCCTGGTTCTCCTTGGAGCT
                    *************************************************** ********

HsCD00004475        GTGATCACTGGAGCTGTGGTCGCTGCTGTGATGTGGAGGAGGAAGAGCTCAGATAGAAAA
XM_005275331.1      GTGATCACTGGAGCTGTGGTCGCTGCTGTGATGTGGAGGAGGAAGAGCTCAGATAGAAAA
NM_001242758.1      GTGATCACTGGAGCTGTGGTCGCTGCCGTGATGTGGAGGAGGAAGAGCTCAGATAGAAAA
NM_002116.7         GTGATCACTGGAGCTGTGGTCGCTGCCGTGATGTGGAGGAGGAAGAGCTCAGATAGAAAA
                    ************************** *********************************

HsCD00004475        GGAGGGAGCTACTCTCAGGCTGCAAGCAGTGACAGTGCCCAGGGCTCTGATGTGTCTCTC
XM_005275331.1      GGAGGGAGCTACTCTCAGGCTGCAAGCAGTGACAGTGCCCAGGGCTCTGATGTGTCTCTC
NM_001242758.1      GGAGGGAGTTACACTCAGGCTGCAAGCAGTGACAGTGCCCAGGGCTCTGATGTGTCTCTC
NM_002116.7         GGAGGGAGTTACACTCAGGCTGCAAGCAGTGACAGTGCCCAGGGCTCTGATGTGTCCCTC
                    ******** ***:******************************************* ***

HsCD00004475        ACAGCTTGTAAAGTGTTG------------------------------------------
XM_005275331.1      ACAGCTTGTAAAGGTGAGAGCCTGGAGGGCCTGATGTGTGTTGGGTGTTGGGCGGAACAG
NM_001242758.1      ACAGCTTGTAAAGTGTGA------------------------------------------
NM_002116.7         ACAGCTTGTAAAGTGTGA------------------------------------------
                    *************    .                                          

HsCD00004475        ---------------------------------------------
XM_005275331.1      TGGACACAGCTGTGCTATGGGGTTTCTTTCCATTGGATGTATTGA
NM_001242758.1      ---------------------------------------------
NM_002116.7         ---------------------------------------------
                                                                 

Pathways

NCI : AP-1 transcription factor network
NCI : Downstream signaling in naïve CD8+ T cells
NCI : IL12-mediated signaling events
NCI : TCR signaling in naïve CD8+ T cells
Reactome : Adaptive Immune System
Reactome : Antigen Presentation: Folding, assembly and peptide loading of class I MHC
Reactome : Antigen processing-Cross presentation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : Endosomal/Vacuolar pathway
Reactome : ER-Phagosome pathway
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Interferon Signaling
Reactome : Nef mediated downregulation of MHC class I complex cell surface expression
Reactome : Nef-mediates down modulation of cell surface receptors by recruiting them to clathrin adapters
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
WikiPathway : Proteasome Degradation

Protein

SMART domain : IGc1 : Immunoglobulin C-Type
UniProt : B1PKY1
UniProt : B2R7U3
UniProt : P04439
HPRD : 00826

Clone

Cloning Information : 24925
HIP Master Clone ID : 55301
Original Clone ID : FLH024925.01L

Organism


TAX_ID : 9606
Species Specific ID: 3105

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000206503

Reagents

Labome : HLA-A-antibody